{"product_id":"biolegend-305249","title":"Biolegend, 305249, TotalSeq™-D0005 anti-human CD80 Antibody, 10μg","description":"\u003cp\u003eCD80, also known as B7-1, B7, and BB1, is a 60 kD single chain type I glycoprotein belonging to the immunoglobulin superfamily. CD80 is expressed on activated B and T cells, macrophages, and dendritic cells. CD80 binds to CD28 and CD152 (CTLA-4). Along with CD86, CD80 plays a critical role in regulation of T cell activation. The interaction of CD80 with CD28 provides a potent costimulatory signal for T cell activation through the CD3 complex, while its interaction with CTLA-4 provides an inhibitory signal for T cell activation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: in vitro blocking of T cell activation, immunohistochemical staining of acetone-fixed frozen tissue sections2, immunoprecipitation, and Western blotting3. The Ultra-LEAF™ purified antibody (Endotoxin \u0026lt;0.1 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 305245 \u0026amp; 305246).\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London. Battifora M. 1998. J. Clin. Endocr. Metab. 83:4130. (IHC) Van der Merwe PA, et al. 1997. J. Exp. Med. 185:3. (WB) Jayakumar A, et al. 2008. Infect. Immun. 76:2138. PubMed Schubert DA, et al. 2012. J. Exp Med. 209:335. PubMed Wen T, et al. 2014. J Immunol. 192:5481. PubMed\u003cbr\u003e\nRRID: AB_2892361 (BioLegend Cat. No. 305249)\u003cbr\u003e\nStructure: Ig superfamily, type I transmembrane glycoprotein, 60 kD\u003cbr\u003e\nDistribution: Activated B cells and T cells, macrophages, and dendritic cells\u003cbr\u003e\nFunction: T cell costimulation\u003cbr\u003e\nLigand\/Receptor: CD28, CD152 (CTLA-4)\u003cbr\u003e\nCell Type: B cells, Dendritic cells, Macrophages, T cells, Tregs\u003cbr\u003e\nBiology Area: Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers\u003cbr\u003e\nMolecular Family: CD Molecules, Immune Checkpoint Receptors\u003cbr\u003e\nAntigen References: 1. Freeman G, et al. 1991. J. Exp. Med. 174:625. 2. Linsley P, et al. 1996. Immunity 4:535. 3. Linsley P, et al. 1991. J. Exp. Med. 174:561.\u003cbr\u003e\nGene ID: 941\u003cbr\u003e\nUniProt: View information about CD80 on UniProt.org\u003cbr\u003e\nClone: 2D10\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: VI CD80.1\u003cbr\u003e\nOther Names: B7-1, B7, BB1\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: ACGAATCAATCTGTG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862306771113,"sku":"305249","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-305249","provider":"Iright","version":"1.0","type":"link"}