{"product_id":"biolegend-311455","title":"Biolegend, 311455, TotalSeq™-D0058 anti-human HLA-A,B,C Antibody, 10μg","description":"\u003cp\u003eMHC class I antigens associated with β2-microglobulin are expressed by all human nucleated cells. MHC class I molecules are involved in presentation of antigens to CD8 + T cells. They play an important role in cell-mediated immune responses and tumor surveillance.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human, Cynomolgus, Rhesus\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cat, Cow, Chimpanzee\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone W6\/32 recognizes residues in the N terminus of the human ß2-microglobulin molecule21.Additional reported applications (for the relevant formats) include: immunoprecipitaton2, Western blotting (non-reducing)3, immunohistochemical staining of acetone-fixed frozen tissue sections4,5, blocking6,7, inhibition of NK cell-mediated lysis10, and activation8,9. Clone W6\/32 has been reported not to be suitable for immunohistochemistry on paraffin sections17. The LEAF™ purified antibody (Endotoxin \u0026lt; 0.1 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays. For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 311428) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin \u0026lt; 0.01 EU\/µg).\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Darrow TL, et al. 1989. J. Immunol. 142:3329. Stern P, et al. 1987. J. Immunol. 138:1088. Tran TM, et al. 2001. Immunogenetics 53:440. Barbatis C, et al. 1981. Gut 22:985. Ayyoub M, et al. 2004. Cancer Immunity 4:7. DeFelice M, et al. 1990. Cell. Immunol. 126:420. Fayen J, et al. 1998. Int. Immunol. 10:1347. Turco MC, et al. 1988. J. Immunol. 141:2275. Geppert TD, et al. 1989. J. Immunol. 142:3763. Wooden SL, et al. 2005. J. Immunol. 175:1383. Nagano M, et al. 2007. Blood 110:151. McLoughlin RM,et al.2008. J. Immunol. 181:1323. PubMed Takahara M, et al.2008. J. Leukoc. Biol. 83:742. PubMed Lunemann A, et al.2008. J. Immunol. 181:6170. PubMed Laing BJ, et al. 2010. J. Thorac Cardiovasc Surg. 139:1402. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Vambutas A, et al. 2000. Clin. Diagn. Lab. Immun. 7:79. Coppieters KT, et al. 2012. J. Exp. Med. 209:51. (epitope) Crivello P, et al. 2013. Hum Immunol. 22:100. PubMed Jung Y, et al. 2015. Mol Cancer Res. 13:197. PubMed Shields MJ. Ribaudo RK. 1998. Tissue Antigens. 51(5):567-70. (epitope)\u003cbr\u003e\nRRID: AB_2894581 (BioLegend Cat. No. 311455)\u003cbr\u003e\nStructure: Ig superfamily\u003cbr\u003e\nDistribution: All nucleated cells\u003cbr\u003e\nFunction: Antigen presentation\u003cbr\u003e\nLigand\/Receptor: CD3\/TCR, CD8\u003cbr\u003e\nBiology Area: Immunology, Innate Immunity\u003cbr\u003e\nMolecular Family: MHC Antigens\u003cbr\u003e\nAntigen References: 1. Barclay AN, et al. Eds. 1993. The Leukocyte Antigen FactsBook. Academic Press Inc. San Diego.\u003cbr\u003e\nGene ID: 3105\u003cbr\u003e\nUniProt: View information about HLA-A on UniProt.org\u003cbr\u003e\nClone: W6\/32\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: Major Histocompatibility Class I, MHC class I\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: TATGCGAGGCTTATC\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46866441699497,"sku":"311455","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-311455","provider":"Iright","version":"1.0","type":"link"}