{"product_id":"biolegend-315611","title":"Biolegend, 315611, TotalSeq™-D0374 anti-human CD98 Antibody, 10μg","description":"\u003cp\u003eCD98 is a 125 kD disulfide-linked heterodimer protein also known as 4F2 and FRP-1. It is broadly expressed on activated and transformed cells (hematopoietic and non-hematopoietic), and at low levels on quiescent cells. CD98 has been characterized as a potential amino acid transporter (neutral and dibasic amino acids) that is involved in lymphocyte activation and integrin signaling. CD98 is composed of a light chain (45 kD) and a heavy chain (80 kD). Studies with knock-out mice indicate that the CD98 heavy chain is involved in integrin-dependent cell spreading and protection against anchorage deprivation-induced apoptosis. The MEM-108 antibody is useful for flow cytometry and immunoprecipitation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Burkitt's lymphoma cell line Raji\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York. Cantor J, et al. 2011. J. Immunol. 187:851. PubMed.\u003cbr\u003e\nRRID: AB_2941487 (BioLegend Cat. No. 315611)\u003cbr\u003e\nStructure: Disulfide-linked heterodimer, 80 kD and 45 kD reduced, 125 kD unreduced\u003cbr\u003e\nDistribution: Broadly expressed on activated and transformed cells, not hematopoietic cell-specific. Lower levels on resting cells\u003cbr\u003e\nFunction: Potential amino acid transporter (neutral and dibasic amino acids) also involved in the activation of lymphocytes and integrin signaling. May be a target antigen for NK cells\u003cbr\u003e\nInteraction: Actin, β1 integrins (α2β1, α3β1, α5β1, α6β1; minimally with α4β1)\u003cbr\u003e\nModification: Glycosylated (heavy chain)\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Leukocyte Typing VI. Kishimoto T, et al. (Eds.) Garland Publishing Inc. (1997) 2. Bron C, et al. 1986. J. Immunol. 137:397. 3. Lumadue JA, et al. 1987. Proc. Natl. Acad. Sci. 84:9204. 4. Mastroberardino L, et al. 1998. Nature 395:288.\u003cbr\u003e\nGene ID: 6520\u003cbr\u003e\nUniProt: View information about CD98 on UniProt.org\u003cbr\u003e\nClone: MEM-108\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: 4F2, FRP-1, RL-388\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: GCACCAACAGCCATT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46866462605481,"sku":"315611","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-315611","provider":"Iright","version":"1.0","type":"link"}