{"product_id":"biolegend-334651","title":"Biolegend, 334651, TotalSeq™-D0352 anti-human FcεRIα Antibody, 10μg","description":"\u003cp\u003eHigh affinity IgE receptor (FcεRI) plays a key role in IgE-mediated allergic immune response. FcεRI is a tetrameric receptor complex, which is composed of one α-subunit (FcεRIα), one β-subunit, and two γ-subunits. FcεRIα directly binds IgE with high affinity, while the β- and γ-chains are responsible for mediating intracellular signals. FcεRIα is a 50 kD transmembrane protein with Ig superfamily structure. It is primarily found on mast cells and basophils. Further studies have indicated that FcεRIα is also expressed on many inflammatory cells including cutaneuos Langerhans cells, dendritic cells, monocytes of patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils produced in hypereosinophilic syndrome, and neutrophils from allergy-induced asthma patients.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone AER-37 (CRA-1) has been reported to bind the receptor even in the presence of IgE.4\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Yamaguchi M, et al. 1999. J. Immunol. 162:5455. Suzukawa M, et al. 2005. Int. Immunol. 17:1249. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed Yamaguchi M, et al. 1999. J. Immunol. 162:5455.\u003cbr\u003e\nRRID: AB_2892406 (BioLegend Cat. No. 334651)\u003cbr\u003e\nStructure: Ig superfamily, 50 kD\u003cbr\u003e\nDistribution: Mast cells, basophils, cutaneuos Langerhans cells, dendritic cells, and monocytes from the patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils from hypereosinophilic syndrome, neutrophils from allergic asthmatic patients\u003cbr\u003e\nFunction: Bind IgE, trigger IgE-mediated allergic response\u003cbr\u003e\nLigand\/Receptor: IgE\u003cbr\u003e\nCell Type: Basophils, Dendritic cells, Eosinophils, Langerhans cells, Mast cells, Monocytes, Neutrophils\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: Fc Receptors\u003cbr\u003e\nAntigen References: 1. Riske F, et al. 1991. J. Biol. Chem. 266:11245 2. Gounni AS, et al. 2001. FASEB J. 15:940. 3. Maurer D, et al. 1996. J. Immunol. 157:607 4. Maurer d, et al. 1994. J. Exp. Med. 179:745 5. Campbell AM, et al. 1998. Am. J. Respir. Cell Mol. Biol. 19:92.\u003cbr\u003e\nGene ID: 2205\u003cbr\u003e\nUniProt: View information about FcepsilonRIalpha on UniProt.org\u003cbr\u003e\nClone: AER-37 (CRA-1)\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: FceRIa, FceRI-a, FceRI-alpha, FceRI alpha, high affinity IgE receptor\u003cbr\u003e\nIsotype: Mouse IgG2b, κ\u003cbr\u003e\nBarcode Sequence: CTCGTTTCCGTATCG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862533132457,"sku":"334651","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-334651","provider":"Iright","version":"1.0","type":"link"}