{"product_id":"biolegend-338835","title":"Biolegend, 338835, TotalSeq™-D0125 anti-human CD44 Antibody, 10μg","description":"\u003cp\u003eCD44 is a 80-95 kD glycoprotein also known as Hermes, Pgp1, H-CAM, or HUTCH. It is expressed on all leukocytes, endothelial cells, hepatocytes, and mesenchymal cells. As B and T cells become activated or progress to the memory stage, CD44 expression increases from a low or mid level of intensity to high expression levels. Thus, CD44 has been reported to be a valuable marker for memory cell subsets. CD44 is an adhesion molecule involved in leukocyte attachment to and rolling on endothelial cells, homing to peripheral lymphoid organs and to the sites of inflammation, and leukocyte aggregation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Normal human PBL\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Kishimoto T, et al. eds. 1997 Leucocyte Typing VI:White Cell Differentiation Antigen. Garland Publishing Inc.\u003cbr\u003e\nRRID: AB_2892410 (BioLegend Cat. No. 338835)\u003cbr\u003e\nStructure: Variable splicing of CD44 gene generates many CD44 isoforms, 85 kD\u003cbr\u003e\nDistribution: All leukocytes, epithelial cells, endothelial cells, hepatocytes, mesenchymal cells\u003cbr\u003e\nFunction: Leukocyte attachment and rolling on endothelial cells, stromal cells and ECM\u003cbr\u003e\nLigand\/Receptor: Hyaluronan, MIP-1β, fibronectin, collagen\u003cbr\u003e\nCell Type: Endothelial cells, Epithelial cells, Leukocytes, Mesenchymal cells, Mesenchymal Stem Cells, Tregs\u003cbr\u003e\nBiology Area: Cell Adhesion, Cell Biology, Immunology, Stem Cells\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: 1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press. 2. Haynes BF, et al. 1991. Cancer Cells 3:347. 3. Goldstein LA, et al. 1989. Cell 56:1063. 4. Mikecz K, et al. 1995. Nat. Med. 1:558.\u003cbr\u003e\nGene ID: 960\u003cbr\u003e\nUniProt: View information about CD44 on UniProt.org\u003cbr\u003e\nClone: BJ18\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: VI A034\u003cbr\u003e\nOther Names: Hermes, Pgp-1, H-CAM, HUTCH-1, ECMR III, gp85, Ly-24\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: AATCCTTCCGAATGT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862909964457,"sku":"338835","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-338835","provider":"Iright","version":"1.0","type":"link"}