{"product_id":"biolegend-347331","title":"Biolegend, 347331, TotalSeq™-D0398 anti-human CD115 (CSF-1R) Antibody, 10μg","description":"\u003cp\u003eCSF-1R, also known as CD115 and M-CSFR, is a single-pass type I membrane protein and member of the platelet-derived growth factor receptor family. Structural studies of CD115 have described an Ig-like extracellular domain, a transmembrane domain, an intracellular juxtamembrane domain, a split tyrosine kinase domain, and a C-terminal tail receptor. Receptor activation induces homodimerization in addition to phosphorylation and ubiquitinylation of intracellular residues. The natural ligands of CD115 include M-CSF and IL-34. CD115 directly influences tissue macrophage and osteoclast differentiation and proliferation. It is expressed on monocytes\/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Rat\u003cbr\u003e\nImmunogen: C-fms transduced Kirsten strain murine sarcoma virus transformed NRK cells.\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation. Pre-treatment with EDTA and low temperatures (2 to 8°C) helps in maintaining surface expression of CD1151.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Breslin WL, et al. 2013. J Immunol Methods. 390(1-2):1 PubMed\u003cbr\u003e\nRRID: AB_2922564 (BioLegend Cat. No. 347331)\u003cbr\u003e\nStructure: Single-pass type I membrane protein and is 150 kD.\u003cbr\u003e\nDistribution: Monocytes\/macrophages, plasmacytoid and conventional dendritic cells, and osteoclasts.\u003cbr\u003e\nLigand\/Receptor: Macrophage Colony Stimulating Factor (M-CSF) and IL-34.\u003cbr\u003e\nCell Type: Dendritic cells, Macrophages, Monocytes, Osteoclasts\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Cytokine\/Chemokine Receptors\u003cbr\u003e\nAntigen References: 1. Sherr CJ, et al. 1989. Blood 73:1786 2. Roussel MF, et al. 1991. Nature 353:361. 3. Roussel MF, et al. 1989 P. Natl. Acad. Sci. USA 86:7924.\u003cbr\u003e\nGene ID: 1436\u003cbr\u003e\nUniProt: View information about CD115 on UniProt.org\u003cbr\u003e\nClone: 9-4D2-1E4\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V MA199\u003cbr\u003e\nOther Names: M-CSFR,CSF-1R, FMS, CSF-1 Receptor\u003cbr\u003e\nIsotype: Rat IgG1, κ\u003cbr\u003e\nBarcode Sequence: AATCACGGTCCTTGT\u003cbr\u003e\nQ: Why do I have a weak CD115 staining?\u003cbr\u003e\nA: It has been reported that CD115 can be rapidly internalized, especially when samples are exposed to room temperature. Approximate 33% decrease in CD115 expression has been observed between 0 and 4 hours after sample collection, while overnight incubation of the cells results in complete CD115 downregulation.  Pre-treatment with EDTA and low temperatures (2 - 8°C) helps in maintaining surface expression of CD115. In addition, brief fixation of the cells with Fixation Buffer (Cat. No. 420801) for 10 minutes will block CD115 internalization.\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862497480873,"sku":"347331","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-347331","provider":"Iright","version":"1.0","type":"link"}