{"product_id":"biolegend-353267","title":"Biolegend, 353267, TotalSeq™-D0148 anti-human CD197 (CCR7) Antibody, 10μg","description":"\u003cp\u003eCCR7, also known as CD197, is a chemokine receptor that binds CCL19 and CCL21. CCR7 and its ligands link innate and adaptive immunity by affecting interactions between T cells and dendritic cells and their downstream effect. Naïve T cells enter the lymph node through high endothelial venules, which express CCL21. Dendritic cells and macrophages enter the lymph node through afferent lymphatics. The encounter of T cells and dendritic cells in the T cell zone is CCR7-dependent. In addition, during immunological surveillance, B cells recirculate between B-cell-rich compartments (follicles or B cell zones) in secondary lymphoid organs, surveying for antigen. After antigen binding, B cells move to the boundary of B and T zones to interact with T-helper cells; this B cell migration is directed by CCR7 and its ligands. CCR7-positive cancer cell expression has been associated with lymph node metastasis.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: CCR7-transfected cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_2894573 (BioLegend Cat. No. 353267)\u003cbr\u003e\nStructure: Chemokine receptor, G protein-coupled receptors (GPCR), seven transmembrane receptor.\u003cbr\u003e\nDistribution: T cells, B cells, NK, dendritic cells.\u003cbr\u003e\nFunction: The chemokine receptor CCR7 plays a pivotal role in the homing of naïve T cells and regulatory T cells to secondary lymphoid organs, and the migration of dendritic cells into afferent lymphatic vessels.\u003cbr\u003e\nLigand\/Receptor: CCL19 and CCL21.\u003cbr\u003e\nCell Type: B cells, Dendritic cells, NK cells, T cells\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Cytokine\/Chemokine Receptors, GPCR\u003cbr\u003e\nAntigen References: 1. Yanagihara S, et al. 1998. J. Immunol. 161:3096. 2. Charo IF, et al. 2006. N. Engl. J. Med. 354:610. 3. Reif K, et al. 2002. Nature 416:94. 4. Nakata B, et al. 2008. Oncology 74:69. 5. Brodie T. et al. 2013. Cytometry A. 6: 530-2. PubMed 6. Graves A.J. et al. 2014. Cytometry A. 7: 576–9 PubMed 7. Moncunill G. et al. 2014. Cytometry A. 12: 995-8 PubMed\u003cbr\u003e\nGene ID: 1236\u003cbr\u003e\nUniProt: View information about CD197 on UniProt.org\u003cbr\u003e\nClone: G043H7\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: BLR2, CDw197, EBI1, CMKBR7\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: AGTTCAGTCAACCGA\u003cbr\u003e\nQ: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?\u003cbr\u003e\nA: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46866098815145,"sku":"353267","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-353267","provider":"Iright","version":"1.0","type":"link"}