{"product_id":"biolegend-354931","title":"Biolegend, 354931, TotalSeq™-D0181 anti-human CD21 Antibody, 10μg","description":"\u003cp\u003eCD21 is a 145 kD transmembrane protein also known as complement C3d receptor (C3dR), complement receptor 2 (CR2), and Epstein-Barr virus receptor. CD21 is expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, and some epithelial cells. CD21 is the receptor used by Epstein-Barr virus to infect B cells and is also the complement receptor for C3d. CD21 has also been shown to interact with a number of proteins, including CD23, CD19, annexin VI, CD81, iC3b, complement receptor 1 (CR1, CD35), and interferon-alpha 1 (IFN-α1).\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Björck P, et al. 1993. Eur. J. Immunol. 23:1771. Frémeaux-Bacchi V, et al. 1996. Eur. J. Immunol. 26:1497. Ling NR, et al. 1995. Clin. Exp. Immunol. 101:369. Wang, C, et al. 2011. BMC Immunol. 12:53. (IHC)\u003cbr\u003e\nRRID: AB_2924554 (BioLegend Cat. No. 354931)\u003cbr\u003e\nStructure: Transmembrane protein, multiple SUSHI domains, approximate molecular weight 145 kD\u003cbr\u003e\nDistribution: Expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, some epithelial cells\u003cbr\u003e\nFunction: Epstein-Barr virus receptor on B cells used for infection\u003cbr\u003e\nInteraction: CD23, CD19, complement component 3, annexin VI, CD81, iC3b, complement receptor 1, interferon alpha 1\u003cbr\u003e\nLigand\/Receptor: C3d, EBV\u003cbr\u003e\nCell Type: B cells, Dendritic cells, Epithelial cells, T cells, Thymocytes\u003cbr\u003e\nBiology Area: Cell Biology, Complement, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Kishimoto T, Eds. 1997. Leukocyte Typing VI. Garland Publishing Inc. 2. Moore MD, et al. 1987. Proc. Natl. Acad. Sci. USA 84:9194. 3. Szakonyi G, et al. 2001. Science 292:1725. 4. Weis JJ, et al. 1984. Proc. Natl. Acad. Sci. USA 81:881.\u003cbr\u003e\nGene ID: 1380\u003cbr\u003e\nUniProt: View information about CD21 on UniProt.org\u003cbr\u003e\nClone: Bu32\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V CD21.4, VI CD21.5\u003cbr\u003e\nOther Names: Complement C3d receptor (C3dR), complement receptor 2 (CR2), Epstein-Barr virus receptor\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: AACCTAGTAGTTCGG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862921924777,"sku":"354931","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-354931","provider":"Iright","version":"1.0","type":"link"}