{"product_id":"biolegend-357539","title":"Biolegend, 357539, TotalSeq™-D0056 anti-human CD269 (BCMA) Antibody, 10μg","description":"\u003cp\u003eCD269, also known as B cell maturation antigen (BCMA), is a 27 kD, single pass transmembrane protein with one TNFR-Cys repeat on its extracellular domain. CD269 is a B cell maturation factor, essential for the long-term survival of plasma cells. It is expressed by plasmablasts, plasma cells, and germinal center B cells. The ligands of CD269 are BAFF and APRIL, and its cytoplasmic domain binds several of the TRAF family members.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: BCMA-mouse IgG Fc fusion protein\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_3662390 (BioLegend Cat. No. 357539)\u003cbr\u003e\nStructure: Single pass transmembrane protein, member of the TNFR superfamily, 1 TNFR-Cys domain, 27 kD\u003cbr\u003e\nDistribution: Plasmablasts, plasma cells, germinal center B cells\u003cbr\u003e\nFunction: B cell maturation factor, essential for survival of plasma cells\u003cbr\u003e\nInteraction: Associates with several TRAF family members\u003cbr\u003e\nLigand\/Receptor: BAFF, APRIL\u003cbr\u003e\nCell Type: B cells, Plasma cells\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Coquery CM and Erickson LD. 2012. Crit. Rev. Immunol. 32:287. 2. Notas G, et al. 2012. J. Immunol. 189:4748. 3. Rickert RC, et al. 2011. Immunol. Rev. 244:115. 4. Mesin L, et al. 2011. J. Immunol. 187:2867.\u003cbr\u003e\nGene ID: 608\u003cbr\u003e\nUniProt: View information about CD269 on UniProt.org\u003cbr\u003e\nClone: 19F2\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: BCM, TNFRSF17\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: CAGATGATCCACCAT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860831948969,"sku":"357539","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-357539","provider":"Iright","version":"1.0","type":"link"}