{"product_id":"biolegend-392919","title":"Biolegend, 392919, TotalSeq™-D0166 anti-human CD66b Antibody, 10μg","description":"\u003cp\u003eCD66b is a 95-100 kD glycosylphosphatidylinositol (GPI)-linked protein also known as CD67, CGM6, and NCA-95. CD66b is a member of the immunoglobulin superfamily, carcinoembryonic antigen (CEA)-like subfamily. CD66b, expressed on granulocytes, has been reported to induce activation in neutrophils and to be involved in heterophilic adhesion with CD66c.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Recombinant soluble human CEACAM8-Fc produced in HEK293 cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Singer, et al. 2014. PLoS One. 9(4):e94106. PMID: 24743304 Klaile, et al. 2013. Respir Res. 14:85. PMID 23941132\u003cbr\u003e\nRRID: AB_2922618 (BioLegend Cat. No. 392919)\u003cbr\u003e\nStructure: Ig superfamily, CEA antigen group, GPI-linked glycoprotein\u003cbr\u003e\nDistribution: Granulocytes\u003cbr\u003e\nFunction: Cell adhesion, neutrophil activation\u003cbr\u003e\nLigand\/Receptor: CD66c\u003cbr\u003e\nCell Type: Granulocytes\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: Kuijpers T, et al. 1993. J Immunol. 151:4934. Kuroki M, et al. 1992. J Leuk Biol. 52:551.\u003cbr\u003e\nGene ID: 1088\u003cbr\u003e\nUniProt: View information about CD66b on UniProt.org\u003cbr\u003e\nClone: 6\/40c\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: CEACAM8, CD67, CGM6, NCA-95\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: AGCTGTAAGTTTCGG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862465630377,"sku":"392919","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/biolegend-392919","provider":"Iright","version":"1.0","type":"link"}