{"product_id":"proteintech-g60007-1-5c","title":"Proteintech, G60007-1-5C, MultiPro® 5CFLX Anti-Human TGFBI\/BIGH3 (3E11D11)","description":"Size: 10ug\nThe TGFBI \/ BIGH3 (G60007-1-5C) by Proteintech is a Monoclonal antibody targeting TGFBI \/ BIGH3 in Single Cell (Intra) applications with reactivity to Human samples\nG60007-1-5C targets TGFBI \/ BIGH3 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nTGFBI, also named as BIGH3, Kerato-epithelin and RGD-CAP, binds to type I, II, and IV collagens. TGFBI is an adhesion protein which may play an important role in cell-collagen interactions. In cartilage, it may be involved in endochondral bone formation. TGFBI is an extracellular matrix adaptor protein, it has been reported to be differentially expressed in transformed tissues. TGFBI is a predictive factor of the response to chemotherapy, and suggest the use of TGFBI-derived peptides as possible therapeutic adjuvants for the enhancement of responses to chemotherapy.(PMID:20509890) Defects in TGFBI are the cause of epithelial basement membrane corneal dystrophy (EBMD). Defects in TGFBI are the cause of corneal dystrophy Groenouw type 1 (CDGG1). Defects in TGFBI are the cause of corneal dystrophy lattice type 1 (CDL1). Defects in TGFBI are a cause of corneal dystrophy Thiel-Behnke type (CDTB). Defects in TGFBI are the cause of Reis-Buecklers corneal dystrophy (CDRB). Defects in TGFBI are the cause of lattice corneal dystrophy type 3A (CDL3A). Defects in TGFBI are the cause of Avellino corneal dystrophy (ACD).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG2a\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: CatNo: Ag0241 Product name: Recombinant human BIGH3 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 199-406 aa of BC000097 Sequence: NIQIHHYPNGIVTVNCARLLKADHHATNGVVHLIDKVISTITNNIQQIIEIEDTFETLRAAVAASGLNTMLEGNGQYTLLAPTNEAFEKIPSETLNRILGDPEALRDLLNNHILKSAMCAEAIVAGLSVETLEGTTLEVGCSGDMLTINGKAIISNKDILATNGVIHYIDELLIPDSAKTLFELAAESDVSTAIDLFRQAGLGNHLSG Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human TGFBI\/BIGH3 (3E11D11)\nCalculated Molecular Weight: 683 aa, 75 kDa\nGenBank Accession Number: BC000097\nGene Symbol: TGFBI\nGene ID (NCBI): 7045\nENSEMBL Gene ID: ENSG00000120708\nRRID: AB_3673898\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCAAGGTAACTGCGCCCATATAAGAAA\nBarcode Sequence: TCCAAGGTAACTGCG\nForm: Liquid\nUNIPROT ID: Q15582\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888299987113,"sku":"G60007-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g60007-1-5c","provider":"Iright","version":"1.0","type":"link"}