{"product_id":"proteintech-g65051-1-5c","title":"Proteintech, G65051-1-5C, MultiPro® 5CFLX Anti-Human CD107a\/LAMP1 (H4A3)","description":"Size: 10ug\nThe CD107a \/ LAMP1 (G65051-1-5C) by Proteintech is a Monoclonal antibody targeting CD107a \/ LAMP1 in Single Cell (Intra) applications with reactivity to Human samples\nG65051-1-5C targets CD107a \/ LAMP1 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nLAMP1 (CD107a) is a heavily glycosylated membrane protein enriched in the lysosomal membrane. LAMP1 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP1 is expressed largely in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane (PMID: 16168398). Elevated LAMP1 expression at the cell surface has also been detected during platelet and granulocytic cell activation, as well as in some tumor cells (PMID: 29085473). LAMP1 functions to provide selectins with carbohydrate ligands. This protein has also been shown to be a marker of degranulation on lymphocytes such as CD8+ and NK cells and may also play a role in tumor cell differentiation and metastasis (PMID: 18835598; 29085473; 9426697).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human adherent peripheral blood cells Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD107a\/LAMP1 (H4A3)\nCalculated Molecular Weight: 45 kDa\nGenBank Accession Number: BC006345\nGene Symbol: LAMP1\nGene ID (NCBI): 3916\nENSEMBL Gene ID: ENSG00000185896\nRRID: AB_3673904\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTACTTCGGATTATATCCCATATAAGAAA\nBarcode Sequence: TACTTCGGATTATAT\nForm: Liquid\nUNIPROT ID: P11279\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888295923881,"sku":"G65051-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65051-1-5c","provider":"Iright","version":"1.0","type":"link"}