{"product_id":"proteintech-g65075-1-5c","title":"Proteintech, G65075-1-5C, MultiPro® 5CFLX Anti-Human CD54\/ICAM-1 (15.2)","description":"Size: 10ug\nThe CD54 (ICAM-1) (G65075-1-5C) by Proteintech is a Monoclonal antibody targeting CD54 (ICAM-1) in Single Cell (Intra) applications with reactivity to Human samples\nG65075-1-5C targets CD54 (ICAM-1) in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nICAM-1 (CD54) is a 90-kDa transmembrane glycoprotein of the immunoglobulin superfamily and is critical for the firm attachment and transmigration of leukocytes out of blood vessels and into tissues (PMID: 19307690). ICAM-1 is expressed by several cell types, typically on endothelial cells and cells of the immune system, and its expression can be up-regulated by various stimuli, including TNF-α, INF-γ, IL-1 and thrombin (PMID: 3086451; 9694714; 15979056). It is a ligand for LFA-1 and Mac-1, serves as a receptor for rhinovirus, and is one of several receptors used by Plasmodium falciparum (PMID: 2566624; 2538244; 2475784).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Rheumatoid synovial cells and human monocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD54\/ICAM-1 (15.2)\nCalculated Molecular Weight: 90 kDa\nGenBank Accession Number: BC015969\nGene Symbol: ICAM-1\nGene ID (NCBI): 3383\nENSEMBL Gene ID: ENSG00000090339\nRRID: AB_3673909\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGTGTTGTGGAGATCCCCATATAAGAAA\nBarcode Sequence: AGTGTTGTGGAGATC\nForm: Liquid\nUNIPROT ID: P05362\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297660585,"sku":"G65075-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65075-1-5c","provider":"Iright","version":"1.0","type":"link"}