{"product_id":"proteintech-g65099-1-5c","title":"Proteintech, G65099-1-5C, MultiPro® 5CFLX Anti-Human CD28 (CD28.2)","description":"Size: 10ug\nThe CD28 (G65099-1-5C) by Proteintech is a Monoclonal antibody targeting CD28 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65099-1-5C targets CD28 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD28 (T-cell-specific surface glycoprotein CD28), also known as T44 and Tp44, is a 44 kD disulfide-linked homodimeric type I glycoprotein (PMID: 2162180). It is a member of the immunoglobulin superfamily and is expressed on most T lineage cells, NK cell subsets, and plasma cells (PMID: 2162180, 8386518). CD28 may affect in vivo immune responses by functioning both as a cell adhesion molecule linking B and T lymphocytes and as the surface component of a novel signal transduction pathway (PMID: 2162180, 3021470). CD28 binds both CD80 and CD86 with a highly conserved motif MYPPY in the CDR3-like loop (PMID: 15696168, 7964482). CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death (PMID: 1348520).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD28 (CD28.2)\nCalculated Molecular Weight: 220 aa, 25 kDa\nGenBank Accession Number: BC093698\nGene Symbol: CD28\nGene ID (NCBI): 940\nENSEMBL Gene ID: ENSG00000178562\nRRID: AB_3673912\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTTATCGCAACGTTACCCATATAAGAAA\nBarcode Sequence: GTTATCGCAACGTTA\nForm: Liquid\nUNIPROT ID: P10747\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296874153,"sku":"G65099-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65099-1-5c","provider":"Iright","version":"1.0","type":"link"}