{"product_id":"proteintech-g65109-1-5c","title":"Proteintech, G65109-1-5C, MultiPro® 5CFLX Anti-Human CD45 (HI30)","description":"Size: 10ug\nThe CD45 (G65109-1-5C) by Proteintech is a Monoclonal antibody targeting CD45 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65109-1-5C targets CD45 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD45, also known as protein tyrosine phosphatase, receptor type C, is a type I transmembrane protein expressed on the surface of all haematopoietic cells with the exception of erythrocytes and platelets (PMID: 3489673; 28615666). CD45 is a pan-haematopoietic cell marker and has been shown to be essential for T- and B-cell activation and signalling (PMID: 9429890; 16378097).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human peripheral blood leucocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD45 (HI30)\nGenBank Accession Number: BC014239\nGene Symbol: CD45\nGene ID (NCBI): 5788\nENSEMBL Gene ID: ENSG00000081237\nRRID: AB_3673914\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCCAATTACCCCCATATAAGAAA\nBarcode Sequence: TGTGAGCCAATTACC\nForm: Liquid\nUNIPROT ID: P08575\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297496745,"sku":"G65109-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65109-1-5c","provider":"Iright","version":"1.0","type":"link"}