{"product_id":"proteintech-g65111-1-5c","title":"Proteintech, G65111-1-5C, MultiPro® 5CFLX Anti-Human CD38 (HIT2)","description":"Size: 10ug\nThe CD38 (G65111-1-5C) by Proteintech is a Monoclonal antibody targeting CD38 in Single Cell (Intra) applications with reactivity to Human samples\nG65111-1-5C targets CD38 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD38, also known as ADP-ribosyl cyclase 1, is a type II transmembrane glycoprotein with a short N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites (PMID: 2319135). The extracellular domain of CD38 has bifunctional enzyme activities that catalyze synthesis of cyclic ADP ribose from nicotinamide adenine dinucleotide (NAD) and hydrolysis of cyclic ADP ribose to adenosine diphosphoribose (PMID: 10636863). CD38 is expressed on a variety of hematopoietic and non-hematopoietic cells and is involved in diverse processes such as generation of calcium-mobilizing metabolites, cell activation, and chemotaxis (PMID: 25938500).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD38 (HIT2)\nCalculated Molecular Weight: 300 aa, 34 kDa\nGenBank Accession Number: BC007964\nGene Symbol: CD38\nGene ID (NCBI): 952\nENSEMBL Gene ID: ENSG00000004468\nRRID: AB_3673916\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTCGATGGTGATCGACCCATATAAGAAA\nBarcode Sequence: TTCGATGGTGATCGA\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297201833,"sku":"G65111-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65111-1-5c","provider":"Iright","version":"1.0","type":"link"}