{"product_id":"proteintech-g65146-1-5c","title":"Proteintech, G65146-1-5C, MultiPro® 5CFLX Anti-Human CD8 (SK1)","description":"Size: 10ug\nThe CD8 (G65146-1-5C) by Proteintech is a Monoclonal antibody targeting CD8 in Single Cell (Intra) applications with reactivity to Human samples\nG65146-1-5C targets CD8 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD8 is a transmembrane glycoprotein composed of two disulfide-linked chains. It can be present as a homodimer of CD8α or as a heterodimer of CD8α and CD8β (PMID: 3264320; 8253791). CD8 is found on most thymocytes. The majority of class I-restricted T cells express mostly the CD8αβ heterodimer while CD8αα homodimers alone have been found on some gut intraepithelial T cells , on some T cell receptor (TCR) γδ T cells and on NK cells (PMID: 2111591; 1831127; 8420975). CD8 acts as a co-receptor that binds to MHC class-I and participates in cytotoxic T cell activation (PMID: 8499079). During T cell development, CD8 is required for positive selection of CD4-\/CD8+ T cells (PMID: 1968084).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD8 (SK1)\nCalculated Molecular Weight: 235 aa, 26 kDa\nGenBank Accession Number: BC025715\nGene Symbol: CD8A\nGene ID (NCBI): 925\nENSEMBL Gene ID: ENSG00000153563\nRRID: AB_3673920\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTAGATTGGTTAACCCCATATAAGAAA\nBarcode Sequence: ATTAGATTGGTTAAC\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888298086569,"sku":"G65146-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65146-1-5c","provider":"Iright","version":"1.0","type":"link"}