{"product_id":"proteintech-g65152-1-5c","title":"Proteintech, G65152-1-5C, MultiPro® 5CFLX Anti-Human CD5 (UCHT2)","description":"Size: 10ug\nThe CD5 (G65152-1-5C) by Proteintech is a Monoclonal antibody targeting CD5 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65152-1-5C targets CD5 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD5 is a type I transmembrane glycoprotein of the scavenger receptor cysteine-rich family (PMID: 12403363). CD5 is expressed on a majority of thymocytes, mature T cells, B cell subsets, and peripheral blood dendritic cells (PMID: 9858516; 6156984; 10379049; 1384337). CD5 may act as a receptor in regulating T-cell proliferation. It functions as a negative regulator of TCR signaling during thymocyte development (PMID: 7542801).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD5 (UCHT2)\nCalculated Molecular Weight: 495 aa, 55 kDa\nGenBank Accession Number: BC027901\nGene Symbol: CD5\nGene ID (NCBI): 921\nENSEMBL Gene ID: ENSG00000110448\nRRID: AB_3673921\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGCCTCGCATTGCACCCATATAAGAAA\nBarcode Sequence: GTGCCTCGCATTGCA\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297595049,"sku":"G65152-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65152-1-5c","provider":"Iright","version":"1.0","type":"link"}