{"product_id":"proteintech-g65167-1-5c","title":"Proteintech, G65167-1-5C, MultiPro® 5CFLX Anti-Human CD62L (DREG56)","description":"Size: 10ug\nThe CD62L (G65167-1-5C) by Proteintech is a Monoclonal antibody targeting CD62L in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65167-1-5C targets CD62L in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD62L, also known as L-selectin or SELL, is a member of the selectin family of adhesion molecules that also include CD62E (E-selectin) and CD62P (P-selectin) (PMID: 2663882, 2473156, 1382078). CD62L is a highly glycosylated protein of 95-105 kDa on neutrophils and 74 kDa on lymphocytes (PMID: 1382078; 1694883, 1695155). CD62L is expressed on the surface of most leukocytes, including lymphocytes, neutrophils, monocytes, eosinophils, hematopoietic progenitor cells, and immature thymocytes (PMID: 1694883, 1688580). It mediates the binding of lymphocytes to high endothelial venules (HEV) of peripheral lymph nodes through interactions with a constitutively expressed ligand, and is also involved in lymphocyte, neutrophil, and monocyte attachment to endothelium at sites of inflammation (PMID: 1382078).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ Mouse IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: PMA-activated human peripheral blood leukocytes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD62L (DREG56)\nCalculated Molecular Weight: 42 kDa\nGenBank Accession Number: BC020758\nGene Symbol: CD62L\nGene ID (NCBI): 6402\nENSEMBL Gene ID: ENSG00000188404\nRRID: AB_3673924\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTCCGGTTCTTGAATCCCATATAAGAAA\nBarcode Sequence: TTCCGGTTCTTGAAT\nForm: Liquid\nUNIPROT ID: P14151\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297824425,"sku":"G65167-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65167-1-5c","provider":"Iright","version":"1.0","type":"link"}