{"product_id":"proteintech-g65169-1-5c","title":"Proteintech, G65169-1-5C, MultiPro® 5CFLX Anti-Human CD163 (GHI\/61)","description":"Size: 10ug\nThe CD163 (G65169-1-5C) by Proteintech is a Monoclonal antibody targeting CD163 in Single Cell (Intra) applications with reactivity to Human samples\nG65169-1-5C targets CD163 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD163, also known as M130, is a membrane glycoprotein which belongs to the scavenger receptor superfamily (PMID: 8370408). It is an acute phase-regulated and signal-inducing macrophage protein expressed exclusively in monocytes and tissue macrophages (PMID: 11196644). CD163 mediates endocytosis of haptoglobin-haemoglobin complexes (PMID: 11196644). The uptake of haptoglobin by macrophages contributes to the recycling of iron and also to the inflammatory response (PMID: 22900885). Soluble CD163 (sCD163), as a result of ectodomain shedding during inflammatory activation of macrophages, circulates in blood and has been suggested as a plasma\/serum marker for macrophage activity (PMID: 12570164).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Glycoprotein preparation from hairy cell leukemia spleen Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD163 (GHI\/61)\nCalculated Molecular Weight: 1156 aa, 125 kDa\nGenBank Accession Number: BC051281\nGene Symbol: CD163\nGene ID (NCBI): 9332\nENSEMBL Gene ID: ENSG00000177575\nRRID: AB_3673925\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGACCGCGACCTGATAACCCATATAAGAAA\nBarcode Sequence: ACCGCGACCTGATAA\nForm: Liquid\nUNIPROT ID: Q86VB7\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296415401,"sku":"G65169-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65169-1-5c","provider":"Iright","version":"1.0","type":"link"}