{"product_id":"proteintech-g65195-1-5c","title":"Proteintech, G65195-1-5C, MultiPro® 5CFLX Anti-Human CD81 (5A6)","description":"Size: 10ug\nThe CD81 (G65195-1-5C) by Proteintech is a Monoclonal antibody targeting CD81 in Single Cell (Intra) applications with reactivity to Human samples\nG65195-1-5C targets CD81 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD81 (also known as TAPA1or TSPAN28) is a membrane protein of the tetraspanin superfamily, which are characterized by the presence of four conserved transmembrane regions. Many of these members are expressed on leukocytes and have been implicated in signal transduction, cell-cell interactions, and cellular activation and development. CD81 is involved in signal transduction and cell adhesion in the immune system (PMID: 9597125). CD81 has also been identified as en essential receptor for HCV (hepatitis C virus) (PMID: 21428934).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human OCI-LY8 cell line Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD81 (5A6)\nCalculated Molecular Weight: 26 kDa\nGenBank Accession Number: BC002978\nGene Symbol: CD81\nGene ID (NCBI): 975\nENSEMBL Gene ID: ENSG00000110651\nRRID: AB_3673932\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTCAATAGTTGGCTACCCATATAAGAAA\nBarcode Sequence: GTCAATAGTTGGCTA\nForm: Liquid\nUNIPROT ID: P60033\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888298217641,"sku":"G65195-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g65195-1-5c","provider":"Iright","version":"1.0","type":"link"}