{"product_id":"proteintech-g66308-1-5c","title":"Proteintech, G66308-1-5C, MultiPro® 5CFLX Anti-Human CD27 (1C1G3)","description":"Size: 10ug\nThe CD27 (G66308-1-5C) by Proteintech is a Monoclonal antibody targeting CD27 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG66308-1-5C targets CD27 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD27 (also known as TNFRSF7) is a type I glycoprotein expressed on some B cells and the majority of T cells, and is a member of the tumor necrosis factor (TNF) receptor family. CD27 is required for generation and long-term maintenance of T cell immunity (PMID: 11062504). It is a receptor for CD70 (CD27L). Ligation of CD27 by CD70 induces strong ubiquitination of TRAF and the activation of both canonical and non-canonical NF-kappaB pathways, as well as the JNK pathway (PMID: 19426224). CD27 may also play a role in apoptosis through association with SIVA1.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: CatNo: Ag24537 Product name: Recombinant human CD27 protein Source: e coli. -derived, PET30a Tag: 6*His Domain: 1-260 aa of BC012160 Sequence: MARPHPWWLCVLGTLVGLSATPAPKSCPERHYWAQGKLCCQMCEPGTFLVKDCDQHRKAAQCDPCIPGVSFSPDHHTRPHCESCRHCNSGLLVRNCTITANAECACRNGWQCRDKECTECDPLPNPSLTARSSQALSPHPQPTHLPYVSEMLEARTAGHMQTLADFRQLPARTLSTHWPPQRSLCSSDFIRILVIFSGMFLVFTLAGALFLHQRRKYRSNKGESPVEPAEPCRYSCPREEEGSTIPIQEDYRKPEPACSP Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD27 (1C1G3)\nCalculated Molecular Weight: 29 kDa\nGenBank Accession Number: BC012160\nGene Symbol: CD27\nGene ID (NCBI): 939\nENSEMBL Gene ID: ENSG00000139193\nRRID: AB_3673946\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCGCAATCAGCCCATATAAGAAA\nBarcode Sequence: TGTGAGCGCAATCAG\nForm: Liquid\nUNIPROT ID: P26842\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296808617,"sku":"G66308-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g66308-1-5c","provider":"Iright","version":"1.0","type":"link"}