{"product_id":"proteintech-g69007-1-5c","title":"Proteintech, G69007-1-5C, MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)","description":"Size: 10ug\nThe NeutraKine® IFN Gamma (G69007-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IFN Gamma in Single Cell (Intra) applications with reactivity to Human samples\nG69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nInterferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.This antibody can be used to neutralize the bioactivity of Interferon gamma.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: CatNo: Product name: HumanKine® recombinant human IFN gamma protein Source: -derived, Tag: Domain: of Sequence: Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)\nGene Symbol: IFNG\nGene ID (NCBI): 3458\nENSEMBL Gene ID: ENSG00000111537\nRRID: AB_3673973\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA\nBarcode Sequence: CGAGAGAATGACTGC\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888298840233,"sku":"G69007-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/ar\/products\/proteintech-g69007-1-5c","provider":"Iright","version":"1.0","type":"link"}