{"product_id":"biolegend-302071","title":"Biolegend, 302071, TotalSeq™-D0083 anti-human CD16 Antibody, 10μg","description":"\u003cp\u003eCD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human, Cynomolgus, Rhesus\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human PMN cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: The 3G8 antibody clone blocks neutrophil phagocytosis and stimulates NK cell proliferation. It has been reported that this clone interacts with the FcγRIIa and FcγRIIIb receptors causing neutrophil activation and aggregation18. Due to this phenomenon staining in whole blood may cause a reduction in the number of granulocytes or alter their scatter profile.Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6, immunoprecipitation3, stimulation of NK cell proliferation4, blocking of phagocytosis5, and blocking of immunoglobulin binding to FcγRIII7,8. The Ultra-LEAF™ purified antibody (Endotoxin \u0026lt; 0.01 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302049, 302050, 302057, 302058).\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Edberg J, et al. 1997. J. Immunol. 159:3849. (IP) Hoshino S, et al. 1991. Blood 78:3232. (Stim) Tamm A, et al. 1996. Immunol. 157:1576. (Block) Da Silva DM, et al. 2001. Int. Immunol. 13:633. (IHC) Holl V, et al. 2004. J. Immunol. 173:6274. (Block) Hober D, et al. 2002. J. Gen. Virol. 83:2169. (Block) Brainard DM, et al. 2009. J. Virol. 83:7305. PubMed Smed-Sörensen A, et al. 2008. Blood 111:5037. (Block) PubMed Timmerman KL, et al. 2008. J. Leukoc. Biol. 84:1271. (FC) PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Rout N, et al. 2010. PLoS One 5:e9787. (FC) Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC) Boltz A, et al. 2011. J. Biol Chem. 286:21896. PubMed Wu Z, et al. 2013. J. Virol. 87:7717. PubMed Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG) Vossebeld PJ, et al. 1997. Biochem J. 323:87-94 (Stim)\u003cbr\u003e\nRRID: AB_2892348 (BioLegend Cat. No. 302071)\u003cbr\u003e\nStructure: Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)\u003cbr\u003e\nDistribution: NK cells, activated monocytes, macrophages, neutrophils\u003cbr\u003e\nFunction: Low affinity IgG Fc receptor, phagocytosis, ADCC\u003cbr\u003e\nLigand\/Receptor: Aggregated IgG, IgG-antigen complex\u003cbr\u003e\nCell Type: Dendritic cells, Macrophages, Monocytes, Neutrophils, NK cells\u003cbr\u003e\nBiology Area: Immunology, Innate Immunity\u003cbr\u003e\nMolecular Family: CD Molecules, Fc Receptors\u003cbr\u003e\nAntigen References: 1. Fleit H, et al. 1982. P. Natl. Acad. Sci. USA 79:3275. 2. Stroncek D, et al. 1991. Blood 77:1572. 3. Wirthmueller U, et al. 1992. J. Exp. Med. 175:1381.\u003cbr\u003e\nGene ID: 2214\u003cbr\u003e\nUniProt: View information about CD16 on UniProt.org\u003cbr\u003e\nClone: 3G8\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V NK80\u003cbr\u003e\nOther Names: FcγRIII, Fc gamma receptor, Fc gamma receptor 3\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: AAGTTCACTCTTTGC\u003cbr\u003e\nQ: Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?\u003cbr\u003e\nA: Yes\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862398652585,"sku":"302071","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-302071","provider":"Iright","version":"1.0","type":"link"}