{"product_id":"biolegend-303151","title":"Biolegend, 303151, TotalSeq™-D0124 anti-human CD31 Antibody, 10μg","description":"\u003cp\u003eCD31 is a 130-140 kD type I transmembrane glycoprotein also known as platelet endothelial cell adhesion molecule-1 (PECAM-1) or Endocam. It is expressed on monocytes, platelets, granulocytes, endothelial cells and lymphocyte subsets. CD31 has been reported to bind CD38 and be involved in wound healing, angiogenesis, and cellular migration in an inflammatory situation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human, Cynomolgus, Rhesus\u003cbr\u003e\nReported Reactivity: African Green, Baboon\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone WM59 has been reported to recognize the D2 extracellular portion of CD31.Additional reported applications (for the relevant formats) include: immunofluorescence microscopy2, immunohistochemical staining of acetone-fixed frozen tissue sections8, blocking of platelet aggregation3, and spatial biology (IBEX)11,12. Clone WM59 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin \u0026lt; 0.01 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303143 \u0026amp; 303144).The purified WM59 antibody is useful as a capture antibody for a sandwich ELISA assay, when used in conjunction with biotin anti-human CD31 antibody (Cat. No. 536604) antibody as the detection antibody.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V Oxford University Press. New York. Muczynski KA, et al. 2003. J. Am. Soc. Nephrol. 14:1336. (IF) Wu XW, et al. 1997. Arterioscl. Throm. Vas. 17:3154. (Block) Nagano M, et al. 2007. Blood 110:151. (FC) PubMed MacFadyen JR, et al. 2005. FEBS Lett. 579:2569. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. Wicki A, et al. 2012. Clin. Cancer Res. 18:454. (FC, IHC) PubMed Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed Bushway ME, et al. 2014. Biol Reprod. 90(5): 110 (IF) PubMed Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed\u003cbr\u003e\nRRID: AB_2922535 (BioLegend Cat. No. 303151)\u003cbr\u003e\nStructure: Ig superfamily, type I transmembrane glycoprotein, 130-140 kD\u003cbr\u003e\nDistribution: Monocytes, platelets, granulocytes, endothelial cells, lymphocyte subset\u003cbr\u003e\nFunction: Cell adhesion, signal transduction\u003cbr\u003e\nLigand\/Receptor: CD38\u003cbr\u003e\nCell Type: Endothelial cells, Granulocytes, Lymphocytes, Monocytes, Neutrophils, Platelets\u003cbr\u003e\nBiology Area: Angiogenesis, Cell Adhesion, Cell Biology, Immunology, Neuroinflammation, Neuroscience\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: DeLisser H, et al. 1994. Immunol. Today 15:490. Newman P, 1997. J. Clin. Invest. 99:3. Fawcett J, et al. 1995. J. Cell Biol. 128:1229.\u003cbr\u003e\nGene ID: 5175\u003cbr\u003e\nUniProt: View information about CD31 on UniProt.org\u003cbr\u003e\nClone: WM59\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V P025\u003cbr\u003e\nOther Names: PECAM-1, EndoCAM\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: ACCTTTATGCCACGG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46864097018025,"sku":"303151","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-303151","provider":"Iright","version":"1.0","type":"link"}