{"product_id":"biolegend-305051","title":"Biolegend, 305051, TotalSeq™-D0162 anti-human CD64 Antibody, 10μg","description":"\u003cp\u003eCD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcR I. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes\/macrophages, dendritic cells, and activated granulocytes. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG\/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human, Cynomolgus, Rhesus\u003cbr\u003e\nReported Reactivity: Baboon, Capuchin Monkey, Chimpanzee, Squirrel Monkey\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Human rheumatoid synovial fluid cells and fibronectin-purified monocytes.\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone 10.1 recognizes the EC3 epitope of CD64. While both contain the EC3 domain, in-house testing suggests that clone 10.1 preferentially binds to CD64A (FcγRIA), but not CD64B (FcγRIB). Additional reported applications (for the relevant formats) include: blocking of human IgG3 and murine IgG2a binding to FcγRI2,5,6,11 and immunohistochemical staining of acetone-fixed frozen tissue sections12.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): McMichael A, et al. Eds. 1987. Leucocyte Typing III. Oxford University Press. New York. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. p. 874. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London. Holl V, et al. 2004. J. Immunol. 173:6274. Hober D, et al. 2002. J. Gen. Virol. 83:2169. Cho HJ, et al. 2007. Physiol Genomics 149:60. van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717. PubMed Bruhns P, et al. 2008. Blood 113:3716. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Carter DL, et al. 1999. Cytometry 37:41. (FC) Dougherty GJ, et al. 1987. Eur. J. Immunol. 17:1453. Blom AB, et al. 2003. Arthritis Rheum. 48(4):1002-14. (IHC)\u003cbr\u003e\nRRID: AB_2892360 (BioLegend Cat. No. 305051)\u003cbr\u003e\nStructure: Ig superfamily, type I glycoprotein, 72 kD\u003cbr\u003e\nDistribution: Monocytes, macrophages, dendritic cells, activated granulocytes\u003cbr\u003e\nFunction: Phagocytosis, ADCC\u003cbr\u003e\nLigand\/Receptor: IgG receptor\u003cbr\u003e\nCell Type: Dendritic cells, Granulocytes, Macrophages, Monocytes\u003cbr\u003e\nBiology Area: Immunology, Innate Immunity\u003cbr\u003e\nMolecular Family: CD Molecules, Fc Receptors\u003cbr\u003e\nAntigen References: 1. Hulett M, et al. 1994. Adv. Immunol. 57:1. 2. van de Winkel J, et al. 1993. Immunol. Today 14:215.\u003cbr\u003e\nGene ID: 2209\u003cbr\u003e\nUniProt: View information about CD64 on UniProt.org\u003cbr\u003e\nClone: 10.1\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: VI MA36\u003cbr\u003e\nOther Names: FcγRI, FcR I, FCGR1A\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: AAGTATGCCCTACGA\u003cbr\u003e\nQ: Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?\u003cbr\u003e\nA: Yes\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860768837801,"sku":"305051","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-305051","provider":"Iright","version":"1.0","type":"link"}