{"product_id":"biolegend-313325","title":"Biolegend, 313325, TotalSeq™-D0351 anti-human CD135 (Flt-3\/Flk-2) Antibody, 10μg","description":"\u003cp\u003eCD135 is a 130-160 kD type III tyrosine kinase receptor expressed on CD34 + hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. CD135 is also expressed on malignant hematopoietic cells including AML, ALL and CML-BC. CD135, also known as FMS-like tyrosine kinase-3, FLT3, STK-1, and Flk-2, is a growth factor receptor that binds the FLT3 ligand to promote the growth and differentiation of primitive hematopoietic cells. The intracytoplasmic domain of CD135 is modified by phosphorylation and has been shown to interact with Grb2, SOCS1, VAV1, and Shc.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: BV-173 pro-B cell line\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_2922546 (BioLegend Cat. No. 313325)\u003cbr\u003e\nStructure: Member of the immunoglobulin supergene family, type 3 tyrosine kinase receptor; 130-160 kD\u003cbr\u003e\nDistribution: Expressed on CD34+ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. Also expressed on AML, ALL and CML-BC tumor cells\u003cbr\u003e\nFunction: Tyrosine kinase growth factor receptor involved in the growth and differentiation of primitive hematopoietic cells\u003cbr\u003e\nLigand\/Receptor: FLT3 ligand\u003cbr\u003e\nCell Type: B cells, Hematopoietic stem and progenitors, Leukemia, Thymocytes\u003cbr\u003e\nBiology Area: Cell Biology, Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Cytokine\/Chemokine Receptors\u003cbr\u003e\nAntigen References: 1. Rappold I, et al. 1997. Blood 90:111. 2. Rosnet O, et al. 1996. Acta Haematol. 95:218. 3. Rosnet O, et al. 1996. Leukemia 10:238. 4. Bertho JM, et al. 2000. Scand. J. Immunol. 52:53.\u003cbr\u003e\nGene ID: 2322\u003cbr\u003e\nUniProt: View information about CD135 on UniProt.org\u003cbr\u003e\nClone: BV10A4H2\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: FMS-like tyrosine kinase-3, FLT-3, STK-1, Flk-2\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CAGTAGATGGAGCAT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862926839977,"sku":"313325","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-313325","provider":"Iright","version":"1.0","type":"link"}