{"product_id":"biolegend-320845","title":"Biolegend, 320845, TotalSeq™-D0165 anti-human CD314 (NKG2D) Antibody, 10μg","description":"\u003cp\u003eCD314 is a homodimeric C-type lectin-like protein also known as NKG2D. It is expressed on NK cells, CD8 + T cells, γ\/δ T cells, and in vitro induced LAK cells. Several molecules have been identified as the ligands for NKG2D, including MHC class-I chain-related protein A (MICA), MICB, and UL16-binding proteins (ULBPs). NKG2D has no intrinsic signaling capacity, but attains this by non-covalent association with DAP10 or DAP12 adaptors. In addition to being a primary activation receptor on NK cells, NKG2D is also a costimulatory receptor for TCR-mediated T cell proliferation and cytokine production. The interaction of NKG2D with its ligands plays a role in the immune surveillance against pathogen and tumor cells, and in the pathogenesis of autoimmune diseases.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: The 1D11 antibody blocks MICA binding to T cells, induces redirected lysis, and costimulates T cells activation and proliferation. Additional reported (for the relevant formats) applications include: immunoprecipitation1,2, blocking of ligand binding, induction of redirected cell lysis, and costimulation of T cells proliferation2-7. For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 320814) with endotoxin \u0026lt; 0.01 EU\/µg, Azide-Free, 0.2 µm filtered.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Wu J, et al. 1999. Science 285:730. Wu J, et al. 2000. J. Exp. Med. 192:1059. Groh V, et al. 2001. Nature Immunol. 2:255. Wu J, et al. 2002. J. Immunol. 169:1236. Roberts A, et al. 2001. J. Immunol. 167:5527. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452. Kraetzel K et al. 2008. Eur. Respir. J. 32:563. PubMed Correia DV, et al. 2011. Blood 118:992. (FC) PubMed Watanbe M, et al. 2014. Int Immunol. PubMed\u003cbr\u003e\nRRID: AB_2936601 (BioLegend Cat. No. 320845)\u003cbr\u003e\nStructure: C-type lectin\u003cbr\u003e\nDistribution: NK cells, γ\/δ T cells, CD8+ T cells\u003cbr\u003e\nFunction: Cytolytic killing of target cells expressing NKG2D ligands, costimulation of NK cells and T cells\u003cbr\u003e\nLigand\/Receptor: MICA, MICB, UL16-binding proteins (ULBPs)\u003cbr\u003e\nCell Type: NK cells, T cells\u003cbr\u003e\nBiology Area: Costimulatory Molecules, Immunology\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Vance RE, et al. 1999. J. Exp. Med. 190:1801. 2. Raulet DH. 2003. Nat. Rev. Immunol. 3:781. 3. Lohwasser S, et al. 1999. Eur. J. Immunol. 29:755. 4. Jamieson AM, et al. 2002. Immunity 17:19. 5. Gilfillan S, et al. 2002. Nat. Immunol. 3:1150. 6. Ho EL, et al. 2002. J. Immunol. 169:3667. 7. Maasho K, et al. 2005. J. Immunol. 174:4480. 8. Groh V, et al. 2003. Proc. Natl. Acad. Sci. USA 100:9452.\u003cbr\u003e\nGene ID: 22914\u003cbr\u003e\nUniProt: View information about CD314 on UniProt.org\u003cbr\u003e\nClone: 1D11\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: NKG2D\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CGTGTTTGTTCCTCA\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860849774761,"sku":"320845","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-320845","provider":"Iright","version":"1.0","type":"link"}