{"product_id":"biolegend-328149","title":"Biolegend, 328149, TotalSeq™-D0060 anti-human CD90 (Thy1) Antibody, 10μg","description":"\u003cp\u003eCD90 is a 25-35 kD GPI-anchored protein, also known as Thy-1. It belongs to the Ig superfamily. Human CD90 is expressed on neuronal cells, a subset of CD34 + cells, a subset of fetal liver cells and fetal thymocytes, fibroblasts, activated endothelial cells, and some leukemia cell lines. CD34 + CD90 + cells are primitive hematopoietic stem cells. It has been reported that Thy-1 binds with β2 and β3 integrins and plays bimodal roles in the regulation of cell adhesion and neurite outgrowth, and inhibits hematopoietic stem cells proliferation and differentiation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Pigtailed Macaque, Rhesus, Pig\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: HEL cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone 5E10 recognizes an epitope on Thy-1 independent of its glycosylation, but is abolished under reducing conditions.4 Additional reported (for the relevant formats) applications include: immunohistochemical staining of acetone-fixed frozen sections, immunoprecipitation1, and immunofluorescence3.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Craig W, et al. 1993. J. Exp. Med. 177:1331. (IP) Gundlach CW 4th, et al. 2011. Bioconjug. Chem. 22:1706. (Pig Reactivity) Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF) Bradley JE, et al. 2013. Lab Invest. 93:365. (Epitope) Donnenberg VS, et al. 2010. Cytometry B. Clin. Cytom. 5:287. (IHC)\u003cbr\u003e\nRRID: AB_2904348 (BioLegend Cat. No. 328149)\u003cbr\u003e\nStructure: 25-35 kD glycoprotein, Ig superfamily\u003cbr\u003e\nDistribution: Subset of CD34+ hematopoietic stem cells, subset of fetal thymocytes, subset of fetal liver cells, fibroblast, activated endothelial cells, neurons and some leukemia cell lines\u003cbr\u003e\nFunction: Regulate hematopoiesis and neural cell growth, cell adhesion\u003cbr\u003e\nLigand\/Receptor: β3 integrin, β2 integrin\u003cbr\u003e\nCell Type: Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors, Leukemia, Mesenchymal Stem Cells, Neurons, Thymocytes\u003cbr\u003e\nBiology Area: Immunology, Stem Cells\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. McKenzie JL, et al. 1981. J. Immunol. 126:843. 2. Avalos AM, et al. 2002. Biol. Res. 35:231. 3. Wetzel A, et al. 2004. J. Immunol. 172:3850.\u003cbr\u003e\nGene ID: 7070\u003cbr\u003e\nUniProt: View information about CD90 on UniProt.org\u003cbr\u003e\nClone: 5E10\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: HCDM listed\u003cbr\u003e\nOther Names: Thy-1, Thy1\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: GCATTGTACGATTCA\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46864151347369,"sku":"328149","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-328149","provider":"Iright","version":"1.0","type":"link"}