{"product_id":"biolegend-331241","title":"Biolegend, 331241, TotalSeq™-D0139 anti-human TCR γ\/δ Antibody, 10μg","description":"\u003cp\u003eT cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α\/β) or a γ and a δ chain (TCR γ\/δ). TCR γ\/δ is involved in the recognition of certain bacterial, self-CD1 molecule, and tumor antigens bound to MHC class I. The γ\/δ TCR associates with CD3 and is expressed on a subset of T cells found in the thymus, the intestinal epithelium, and the peripheral lymphoid tissues and peritoneum. Most γ\/δ T cells are CD4 - \/CD8 - , some are CD8 + . T cells expressing the γ\/δ TCR have been shown to play a role in oral tolerance, innate immune response for some tumor cells, and autoimmune disease. It has been reported that γ\/δ T cells also play a principal role in antigen presentation.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human, Cynomolgus, Rhesus\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Pigtailed Macaque\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Clone B1 is also known as clone B1.1.Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections3 and paraffin-embedded sections5, in vitro blocking, and spatial biology (IBEX)8,9. The Ultra-LEAF™ purified antibody (Endotoxin \u0026lt; 0.01 EU\/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays (Cat. Nos. 331235 and 331236).\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Rodriguez-Gago M, et al. 2001. Transplantation. 72:503. Lehmann FS, et al. 2002. Am. J. Physiol. Gastrointest. Liver. Physiol. 283:G481. (FC) Bordignon M, et al. 2008. Mol. Med. Rep. 1:485. (IHC) Conrad M, et al. 2007. Cytom. Part A 71A:925. (FC) Pollinger B, et al. 2011. J. Immunol. 186:2602. (IHC) Correia DV, et al. 2011. Blood. 118:992. (Block) Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed\u003cbr\u003e\nRRID: AB_2892399 (BioLegend Cat. No. 331241)\u003cbr\u003e\nStructure: Ig superfamily, associates with CD3 complex\u003cbr\u003e\nDistribution: T subset in thymus, intestinal epithelium, peripheral lymphoid tissues and peritoneum\u003cbr\u003e\nFunction: Antigen recognition\u003cbr\u003e\nLigand\/Receptor: Some bacterial or tumor antigens bound MHC class I, CD1 molecule\u003cbr\u003e\nCell Type: Epithelial cells, T cells\u003cbr\u003e\nBiology Area: Adaptive Immunity, Immunology\u003cbr\u003e\nMolecular Family: TCRs\u003cbr\u003e\nAntigen References: 1. Lanier LL, et al. 1987. J. Clin. Immunol. 7:429. 2. Spencer J, et al. 1989. Eur. J. Immunol. 19:1335. 3. Uyemura K, et al. 1991. J. Exp. Med. 174:683. 4. Spada FM, et al. 2000. J. Exp. Med. 191:907.\u003cbr\u003e\nGene ID: 69646965\u003cbr\u003e\nUniProt: View information about TCR gamma\/delta on UniProt.org\u003cbr\u003e\nClone: B1\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: T cell receptor γ\/δ, γ\/δ TCR, TCR-γ\/δ\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CTTCCGATTCATTCA\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862547779753,"sku":"331241","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-331241","provider":"Iright","version":"1.0","type":"link"}