{"product_id":"biolegend-338529","title":"Biolegend, 338529, TotalSeq™-D0897 anti-human CD23 Antibody, 10μg","description":"\u003cp\u003eCD23 is a 45 kD protein, also known as Leu-20, FcεRII, IgE Fc receptor, BLAST-2, B6, and low affinity IgE receptor. It is a member of the Ig family, expressed on most mature B cells, B cells in follicular mantle (but not in proliferating germinal center cells, follicular dendritic cells, monocytes, eosinophils, Langerhans cells, and a subset of T cells (10-15% of tonsillar T cells). CD23 responds to high levels of IgE by downregulating IgE secretion. In human monocytes, CD23 triggering results in release of pro-inflammatory cytokines including TNF-α, IL-1, IL-6, and GM-CSF. CD23 can be proteolytically cleaved to generate soluble CD23 fragments of various molecular weights. In chronic lymphocytic leukemia, levels of soluble CD23 in the serum can be used as a prognostic marker to identify patients at high risk for disease progression. Alternate splicing of exon 2 can also generate two cell-surface isoforms of CD23 differing by 6 amino acids in their cytoplasmic region.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Sugden B and Metzenberg S. 1983. J. Virol. 46:800-807.\u003cbr\u003e\nRRID: AB_2922556 (BioLegend Cat. No. 338529)\u003cbr\u003e\nStructure: Ig family member, type II transmembrane glycoprotein, 45 kD\u003cbr\u003e\nDistribution: B cells, follicular dendritic cells, monocytes, eosinophils, a subset of T cells, Langerhans cells\u003cbr\u003e\nFunction: Regulation of IgE synthesis in human monocytes; CD23 triggering results in release of pro-inflammatory cytokines including TNF-a, IL-1, IL-6, and GM-CSF\u003cbr\u003e\nLigand\/Receptor: IgE, CD19\/CD21\/CD81\u003cbr\u003e\nCell Type: B cells, Dendritic cells, Eosinophils, Langerhans cells, Monocytes, T cells\u003cbr\u003e\nBiology Area: Immunology\u003cbr\u003e\nMolecular Family: CD Molecules, Fc Receptors\u003cbr\u003e\nAntigen References: 1. Ludin C, et al. 1987. EMBO J. 6:109. 2. Delespesse G, et al. 1992. Immunol. Rev. 125:77. 3. Flores-Romo L, et al. 1993. Science 261:1038. 4. Armant M, et al. 1994. J. Exp. Med. 180:1005.\u003cbr\u003e\nGene ID: 2208\u003cbr\u003e\nUniProt: View information about CD23 on UniProt.org\u003cbr\u003e\nClone: EBVCS-5\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: Leu-20, FcεRII, IgE Fc Receptor, BLAST-2, B6, Low affinity IgE receptor\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: TCTGTATAACCGTCT\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46863067938985,"sku":"338529","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-338529","provider":"Iright","version":"1.0","type":"link"}