{"product_id":"biolegend-343915","title":"Biolegend, 343915, TotalSeq™-D1015 anti-human CD166 Antibody, 10μg","description":"\u003cp\u003eCD166, also known as the CD6 ligand or the Activated Leukocyte Cell Adhesion Molecule (ALCAM), is a 100-105 kD transmembrane glycoprotein. It belongs to the Ig superfamily of proteins and expressed on activated T cells, activated monocytes, epithelial cells, fibroblasts, and neurons. CD166 plays an important role in mediating adhesion interactions between thymic epithelial cells and CD6+ cells during intrathymic T cell development. Recently CD166 has also been used as a potential cancer stem cell marker. The antibody reacts with human activated leukocyte cell adhesion molecule (ALCAM).\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon, Cynomolgus, Rhesus\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Cultured human thymic epithelial cells\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections and immunofluorescence.1\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Pretzel D, et al. 2011. Arthritis Res. Ther. 13:R64. (IHC, IF, FC)\u003cbr\u003e\nRRID: AB_2894541 (BioLegend Cat. No. 343915)\u003cbr\u003e\nStructure: A type I transmembrane glycoprotein belonging to the Ig superfamily of proteins.\u003cbr\u003e\nDistribution: CD166 is expressed on activated T cells, activated monocytes, epithelial cells, fibroblasts, and neurons.\u003cbr\u003e\nFunction: Play an important role in mediating adhesion interactions between thymic epithelial cells and CD6+ cells during intrathymic T cell development.\u003cbr\u003e\nLigand\/Receptor: CD6\u003cbr\u003e\nCell Type: Epithelial cells, Fibroblasts, Mesenchymal Stem Cells, Monocytes, Neurons, T cells\u003cbr\u003e\nBiology Area: Immunology, Stem Cells\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: 1. Aruffo A, et al. 1997. Immunol Today. 18(10):498 2. Patel DD, et al. 1995. J. Exp. Med. 181:2213 3. Bowen MA, et al. 1995. J. Exp. Med. 181:1563 4. Horst D, et al. 2009. Cancer Invest. 22:1\u003cbr\u003e\nGene ID: 214\u003cbr\u003e\nUniProt: View information about CD166 on UniProt.org\u003cbr\u003e\nClone: 3A6\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: HCDM listed\u003cbr\u003e\nOther Names: CD6 ligand, Activated Leukocyte Cell Adhesion Molecule (ALCAM)\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CATAAGATTCCGAGC\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862386102441,"sku":"343915","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-343915","provider":"Iright","version":"1.0","type":"link"}