{"product_id":"biolegend-344037","title":"Biolegend, 344037, TotalSeq™-D0577 anti-human CD73 (Ecto-5'-nucleotidase) Antibody, 10μg","description":"\u003cp\u003eCD73 is a 70 kD glycophosphatidylinositol (GPI)-linked 5'-nucleotidase, which is also known as ecto-5'-nucleotidase. It converts adenosine monophosphate (AMP) to adenosine. CD73 is expressed on subsets of T and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells. It has been reported that CD73 costimulates T cell activation, and mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nReported Reactivity: African Green, Baboon\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: Additional reported applications (for the relevant formats) include:immunofluorescence3. Clone AD2 has been noted to induce clustering and internalization of CD73 in vivo and inhibit metastasis in a murine breast cancer xenograft model4.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Nakamura T, et al. 1993. J. Immunol. 151:6933. Liao J, et al. 2011. J Endod. 37:1217. PubMed Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF) Terp MG, et al. 2013. J Immunol. 191: 4165-73 (Block)\u003cbr\u003e\nRRID: AB_2894606 (BioLegend Cat. No. 344037)\u003cbr\u003e\nStructure: GPI-linked 5'-nucleotidase, 70 kD\u003cbr\u003e\nDistribution: Subsets of T cells and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells\u003cbr\u003e\nFunction: Catalyses dephosphorylation of adenosine monophosphate, costimulates T cell activation, mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells\u003cbr\u003e\nCell Type: B cells, Dendritic cells, Endothelial cells, Epithelial cells, Mesenchymal Stem Cells, T cells, Tregs\u003cbr\u003e\nBiology Area: Costimulatory Molecules, Immunology, Stem Cells\u003cbr\u003e\nMolecular Family: Adhesion Molecules, CD Molecules\u003cbr\u003e\nAntigen References: 1. Zola H, et al. 2007. Leukocyte and stromal Cell Molecules:the CD Markers. A John Wiley \u0026amp; Sons Inc, Publication. 2. Airas L and Jalkanen S, et al. 1996. Blood 88:1755. 3. Gutensohn W, et al. 1995. Cell Immunol. 161:213. 4. Airas L, et al. 1995. J. Exp. Med. 182:1603.\u003cbr\u003e\nGene ID: 4907\u003cbr\u003e\nUniProt: View information about CD73 on UniProt.org\u003cbr\u003e\nClone: AD2\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nWorkshop: V B-CD73.3\u003cbr\u003e\nOther Names: Ecto-5'-nucleotidase, E.C3.1.3.5, L-VAP-2, NT5E, 5'-NT\u003cbr\u003e\nIsotype: Mouse IgG1, κ\u003cbr\u003e\nBarcode Sequence: CAGTTCCTCAGTTCG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46862531494057,"sku":"344037","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-344037","provider":"Iright","version":"1.0","type":"link"}