{"product_id":"biolegend-371233","title":"Biolegend, 371233, TotalSeq™-D0360 anti-human CD357 (GITR) Antibody, 10μg","description":"\u003cp\u003eGITR (glucocorticoid-induced TNF receptor family-regulated gene) is a 25 kD TNF receptor superfamily member (also known as AITR and TNFRSF18). GITR is expressed on activated lymphocytes and is upregulated by T cell receptor engagement. The cytoplasmic domain of GITR is homologous to CD40, 4-1BB and CD27 and has been shown to interact with TRAF 1-3, but not TRAF 5 or 6. GITR signaling has been shown to regulate T cell proliferation and TCR-mediated apoptosis, and to break immunological self-tolerance. GITR binds GITRL and is involved in the development of regulatory T cells and to regulate the activity of Th1 subsets.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Recombinant human GITR-Fc chimera\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nRRID: AB_2894619 (BioLegend Cat. No. 371233)\u003cbr\u003e\nStructure: TNFR superfamily, 234-amino acid type I transmembrane protein, 25 kD.\u003cbr\u003e\nDistribution: Activated lymphocytes.\u003cbr\u003e\nFunction: Interacts with TRAF's 1-3, but not TRAF 5 or 6, mediates NF-κB activation through the TRAF2\/NIK pathway.\u003cbr\u003e\nLigand\/Receptor: GITRL\u003cbr\u003e\nCell Type: Lymphocytes, Tregs\u003cbr\u003e\nBiology Area: Costimulatory Molecules, Immunology\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. van der Werf N, et al. 2011. J. Immunol. 187:1411. 2. Shimizu J, et al. 2002. Nat. Immunol. 3:135. 3. McHugh RS, et al. 2002. Immunity 16:311. 4. Kwon B, et al. 1999. J. Biol. Chem. 274:6056.\u003cbr\u003e\nGene ID: 8784\u003cbr\u003e\nUniProt: View information about CD357 on UniProt.org\u003cbr\u003e\nClone: 108-17\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: TNFRSF18, Activation-inducible TNFR, AITR, Glucocorticoid-inducible TNFR\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: ACCTTTCGACACTCG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860777128105,"sku":"371233","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-371233","provider":"Iright","version":"1.0","type":"link"}