{"product_id":"biolegend-372115","title":"Biolegend, 372115, TotalSeq™-D0408 anti-human CD172a (SIRPα) Antibody, 10μg","description":"\u003cp\u003eCD172a, also known as signal-regulatory protein α (SIRPα), is a 85-90 kD, type I transmembrane protein with one V-set Ig-like and two C-set Ig-like domains in the extracellular portion, and two ITIM motifs and a proline-rich region in the cytoplasmic tail. SIRPα is involved in the negative regulation of receptor tyrosine kinase-coupled signaling; the phospho-tyrosine residues of this protein recruit SH2 domain-containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. CD172a is primarily expressed on monocytes\/macrophages, granulocytes, dendritic cells, neurons and by cardiomyocytes derived from human pluripotent stem cells. The ligands of CD172a are CD47, SP-A, and SP-D.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: KG1a cells.\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Majdic O, et al. 1981. Blood. 58:1127.\u003cbr\u003e\nRRID: AB_2941543 (BioLegend Cat. No. 372115)\u003cbr\u003e\nStructure: Type I transmembrane protein, 85-90 kD, one V-set Ig-like and two C-set Ig-like domains in the extracellular portion, two ITIM motifs and a proline-rich region in the cytoplasmic tail.\u003cbr\u003e\nDistribution: Monocytes, macrophages, granulocytes, dendritic cells, neurons and by cardiomyocytes derived from human pluripotent stem cells.\u003cbr\u003e\nFunction: Negative regulation of receptor tyrosine kinase-coupled signaling, mediates macrophage multinucleation, involved in neuronal survival.\u003cbr\u003e\nLigand\/Receptor: CD47, SP-A, and SP-D.\u003cbr\u003e\nCell Type: Dendritic cells, Granulocytes, Macrophages, Monocytes, Neurons\u003cbr\u003e\nBiology Area: Cell Biology, Immunology, Neuroscience Cell Markers\u003cbr\u003e\nMolecular Family: CD Molecules\u003cbr\u003e\nAntigen References: 1. Lv Z, et al. 2015. J. Immunol. 195:661. 2. Hatherley D, et al. 2014. J. Biol. Chem. 289:10024. 3. Zen K, et al. 2013. Nat. Commun. 4:2436. 4. Baba N, et al. 2013. J. Exp. Med. 210:1251. 5. Barclay AN, Brown MH. 2006. Nat. Rev. Immunol. 6:457.\u003cbr\u003e\nGene ID: 140885\u003cbr\u003e\nUniProt: View information about CD172alpha on UniProt.org\u003cbr\u003e\nClone: 15-414\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: BIT, MFR, P84, MYD-1, SHPS1, PTPNS1, CD172 antigen-like family member A\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: CGTGTTTAACTTGAG\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46860810879145,"sku":"372115","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-372115","provider":"Iright","version":"1.0","type":"link"}