{"product_id":"biolegend-372739","title":"Biolegend, 372739, TotalSeq™-D0089 anti-human TIGIT (VSTM3) Antibody, 10μg","description":"\u003cp\u003eT cell immunoreceptor with Ig and ITIM domains (TIGIT), also known as VSTM3 or WUCAM, is a 26 kD, type I transmembrane protein and is a member of the PVR (poliovirus receptor) family of immunoglobulin-like domain containing proteins. TIGIT is expressed on activated T cells, follicular T helper, memory, and regulatory T cells as well as on NK cells. TIGIT is a negative regulator of NK and T cell activation. Expression of TIGIT is associated with decreased functionality of CD8 T cells in chronic viral infection and tumors. TIGIT also promotes the differentiation of tolerogenic phenotype in dendritic cells with an increased secretion of IL-10 and a diminished production of IL-12.\u003cbr\u003e\n10μg\u003cbr\u003e\nVerified Reactivity: Human\u003cbr\u003e\nAntibody Type: Monoclonal\u003cbr\u003e\nHost Species: Mouse\u003cbr\u003e\nImmunogen: Recombinant Human TIGIT.\u003cbr\u003e\nFormulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA\u003cbr\u003e\nPreparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.\u003cbr\u003e\nConcentration: 0.5 mg\/mL\u003cbr\u003e\nStorage \u0026amp; Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.\u003cbr\u003e\nApplication: PG - Quality tested\u003cbr\u003e\nRecommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.\u003cbr\u003e\nApplication Notes: This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).Additional reported applications (for the relevant formats) include: Blocking1.\u003cbr\u003e\nAdditional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com\/totalseq\/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.\u003cbr\u003e\nApplication References(PubMed link indicates BioLegend citation): Stamm H, et al. 2018. Oncogene. Pubmed\u003cbr\u003e\nRRID: AB_2892456 (BioLegend Cat. No. 372739)\u003cbr\u003e\nStructure: 26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.\u003cbr\u003e\nDistribution: Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.\u003cbr\u003e\nFunction: Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.\u003cbr\u003e\nLigand\/Receptor: CD155 (PVR), CD112 (PVRL2, NECTIN-2).\u003cbr\u003e\nCell Type: NK cells, T cells, Tfh, Tregs\u003cbr\u003e\nBiology Area: Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction\u003cbr\u003e\nMolecular Family: Adhesion Molecules, Immune Checkpoint Receptors\u003cbr\u003e\nAntigen References: 1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858. 2. Yu X, et al. 2009. Nat. Immunol. 10:48. 3. Johnston R, et al. 2014. Cancer Cell. 26:923.\u003cbr\u003e\nGene ID: 201633\u003cbr\u003e\nUniProt: View information about TIGIT on UniProt.org\u003cbr\u003e\nClone: A15153G\u003cbr\u003e\nRegulatory Status: RUO\u003cbr\u003e\nOther Names: T-cell immunoreceptor with Ig and ITIM domains, VSIG9, VSTM3, WUCAM\u003cbr\u003e\nIsotype: Mouse IgG2a, κ\u003cbr\u003e\nBarcode Sequence: TTGCTTACCGCCAGA\u003c\/p\u003e","brand":"Biolegend","offers":[{"title":"Default Title","offer_id":46864390521001,"sku":"372739","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/biolegend-372739","provider":"Iright","version":"1.0","type":"link"}