{"product_id":"proteintech-g17038-1-5c","title":"Proteintech, G17038-1-5C, MultiPro® 5CFLX Anti-Human CXCL8\/IL-8 (Polyclonal)","description":"Size: 10ug\nThe CXCL8\/IL-8 (G17038-1-5C) by Proteintech is a Polyclonal antibody targeting CXCL8\/IL-8 in Single Cell (Intra) applications with reactivity to Human samples\nG17038-1-5C targets CXCL8\/IL-8 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nInterleukin 8 (IL-8), also known as CXCL8, which is a member of the CXC chemokine family. This chemokine is secreted by a variety of cell types including monocyte\/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli. IL-8 has two primary functions. It induces chemotaxis in target cells, primarily neutrophils but also other granulocytes, causing them to migrate toward the site of infection. IL-8 also induces phagocytosis once they have arrived. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. IL-8 is also known to be a potent promoter of angiogenesis. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Rabbit \/ IgG\nClass: Oligo Conjugate\nType: Polyclonal\nImmunogen: CatNo: Ag10552 Product name: Recombinant human CXCL8\/IL-8 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 1-99 aa of BC013615 Sequence: MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CXCL8\/IL-8 (Polyclonal)\nCalculated Molecular Weight: 99 aa, 11 kDa\nGenBank Accession Number: BC013615\nGene Symbol: IL-8\nGene ID (NCBI): 3576\nENSEMBL Gene ID: ENSG00000169429\nRRID: AB_3673891\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAGCTGAATAATGGCCCATATAAGAAA\nBarcode Sequence: CGAGCTGAATAATGG\nForm: Liquid\nUNIPROT ID: P10145\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46887728971945,"sku":"G17038-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g17038-1-5c","provider":"Iright","version":"1.0","type":"link"}