{"product_id":"proteintech-g20189-1-5c","title":"Proteintech, G20189-1-5C, MultiPro® 5CFLX Anti-Human MAFB (Polyclonal)","description":"Size: 10ug\nThe MAFB (G20189-1-5C) by Proteintech is a Polyclonal antibody targeting MAFB in Single Cell (Intra) applications with reactivity to Human samples\nG20189-1-5C targets MAFB in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nMAFB (MAF BZIP Transcription Factor B), also known as V-maf musculoaponeurotic fibrosarcoma oncogene homolog B, is a widely expressed basic leucine zipper transcription factor belonging to the Maf family. MAFB expression is significantly elevated in response to a broad range of metabolic and immunological stimuli that promote macrophage M2 polarization, cholesterol efflux, or both, whereas it is strongly down-regulated in response to various pro-inflammatory pathogenic triggers(PMID: 28790455). MAFB is highly expressed in tumor tissues and required for proliferation and tumorigenicity of osteosarcoma cells(PMID: 32234710) and is a marker of tumor-associated macrophages in both mouse and human(PMID: 31679694).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Rabbit \/ IgG\nClass: Oligo Conjugate\nType: Polyclonal\nImmunogen: CatNo: Ag14102 Product name: Recombinant human MAFB protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 168-323 aa of BC036689 Sequence: QASPPPSSAASPAQQLPTSHPGPGPHATASATAAGGNGSVEDRFSDDQLVSMSVRELNRHLRGFTKDEVIRLKQKRRTLKNRGYAQSCRYKRVQQKHHLENEKTQLIQQVEQLKQEVSRLARERDAYKVKCEKLANSGFREAGSTSDSPSSPEFFL Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human MAFB (Polyclonal)\nCalculated Molecular Weight: 323 aa, 36 kDa\nGenBank Accession Number: BC036689\nGene Symbol: MAFB\nGene ID (NCBI): 9935\nENSEMBL Gene ID: ENSG00000204103\nRRID: AB_3673893\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGCGGACCAGGAATCCCATATAAGAAA\nBarcode Sequence: TCGCGGACCAGGAAT\nForm: Liquid\nUNIPROT ID: Q9Y5Q3\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46887729266857,"sku":"G20189-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g20189-1-5c","provider":"Iright","version":"1.0","type":"link"}