{"product_id":"proteintech-g30000-0-5c","title":"Proteintech, G30000-0-5C, MultiPro® 5CFLX Rabbit IgG Isotype Control (Polyclonal)","description":"Size: 10ug\nThe Rabbit IgG control (G30000-0-5C) by Proteintech is a Polyclonal antibody targeting Rabbit IgG control in Single Cell (Intra) applications with reactivity to NA samples\nG30000-0-5C targets Rabbit IgG control in Single Cell (Intra) applications and shows reactivity with NA samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nThis product is Normal rabbit IgG (without immunized) which purified with Protein A. Normal Rabbit IgG is an isotype control antibody, which is used to estimate the non-specific binding of target primary antibodies due to Fc receptor binding or other protein-protein interactions. An isotype control antibody should have the same immunoglobulin type and be used at the same concentration as the test antibody.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: NA\nHost \/ Isotype: Rabbit \/ IgG\nClass: Oligo Conjugate\nType: Polyclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Rabbit IgG Isotype Control (Polyclonal)\nRRID: AB_3673897\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCATACGGCCGCACCCCATATAAGAAA\nBarcode Sequence: TCCATACGGCCGCAC\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46887729594537,"sku":"G30000-0-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g30000-0-5c","provider":"Iright","version":"1.0","type":"link"}