{"product_id":"proteintech-g65053-1-5c","title":"Proteintech, G65053-1-5C, MultiPro® 5CFLX Anti-Human CD107b\/LAMP2 (H4B4)","description":"Size: 10ug\nThe CD107b \/ LAMP2 (G65053-1-5C) by Proteintech is a Monoclonal antibody targeting CD107b \/ LAMP2 in Single Cell (Intra) applications with reactivity to Human samples\nG65053-1-5C targets CD107b \/ LAMP2 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nLAMP2 (CD107b) is a Lysosomal membrane glycoprotein. LAMP2 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP-2 is localized primarily in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane under certain circumstances, e.g., after platelet activation, during granulocytic differentiation and activation, and in some tumor cells (PMID: 12221139). LAMP is involved in lysosomal stability and autophagy (PMID: 12221139). This glycoprotein provides selectins with carbohydrate ligands. LAMP2 may plays a role in tumor cell metastasis (PMID 9426697).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human adherent peripheral blood cells Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD107b\/LAMP2 (H4B4)\nCalculated Molecular Weight: 45 kDa\nGenBank Accession Number: BC002965\nGene Symbol: LAMP2\nGene ID (NCBI): 3920\nENSEMBL Gene ID: ENSG00000005893\nRRID: AB_3673905\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGTTCTCCATCTTGCCCATATAAGAAA\nBarcode Sequence: CCGTTCTCCATCTTG\nForm: Liquid\nUNIPROT ID: P13473\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888295989417,"sku":"G65053-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65053-1-5c","provider":"Iright","version":"1.0","type":"link"}