{"product_id":"proteintech-g65063-1-5c","title":"Proteintech, G65063-1-5C, MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)","description":"Size: 10ug\nThe CD44 (G65063-1-5C) by Proteintech is a Monoclonal antibody targeting CD44 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65063-1-5C targets CD44 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD44 is a type I transmembrane glycoprotein expressed on embryonic stem cells and in various levels on other cell types including connective tissues and bone marrow. CD44 expression is also upregulated in subpopulations of cancer cells and is recognized as a molecular marker for cancer stem cells (PMID: 29747682). It is a cell-surface receptor that mediates cell-cell and cell-matrix interactions through its affinity for hyaluronic acid (HA) and possibly also through its affinity for other ligands (PMID: 10694938). Adhesion with HA plays an important role in cell migration, tumor growth and progression. CD44 is also involved in lymphocyte activation, recirculation and homing, and in hematopoiesis.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG2a, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Purified T cells from human lymph nodes Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)\nCalculated Molecular Weight: 742 aa, 82 kDa\nGenBank Accession Number: BC004372\nGene Symbol: CD44\nGene ID (NCBI): 960\nENSEMBL Gene ID: ENSG00000026508\nRRID: AB_3673907\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGAACAGCGTGCCGATTCCCATATAAGAAA\nBarcode Sequence: AACAGCGTGCCGATT\nForm: Liquid\nUNIPROT ID: P16070\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297463977,"sku":"G65063-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65063-1-5c","provider":"Iright","version":"1.0","type":"link"}