{"product_id":"proteintech-g65110-1-5c","title":"Proteintech, G65110-1-5C, MultiPro® 5CFLX Anti-Human CD19 (HIB19)","description":"Size: 10ug\nThe CD19 (G65110-1-5C) by Proteintech is a Monoclonal antibody targeting CD19 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65110-1-5C targets CD19 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD19 is a 95 kDa type I transmembrane glycoprotein belonging to the immunoglobulin superfamily (PMID: 2472450). It is expressed by B cells and follicular dendritic cells. CD19 is up-regulated at the step of B-lineage commitment during the differentiation of the hematopoietic stem cell, it remains on during subsequent stages of differentiation until finally down-regulated during terminal differentiation into plasma cells (PMID: 8528044). CD19 is involved in B cell development, activation and differentiation. It is the dominant component for the signaling complex on B cells that includes CD21 (CR2), CD81 (TAPA-1) and CD225 and acts as a critical co-receptor for BCR signal transduction (PMID: 23210908).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD19 (HIB19)\nCalculated Molecular Weight: 556 aa, 61 kDa\nGenBank Accession Number: BC006338\nGene Symbol: CD19\nGene ID (NCBI): 930\nENSEMBL Gene ID: ENSG00000177455\nRRID: AB_3673915\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGGCTGGTCCTTCATCCCATATAAGAAA\nBarcode Sequence: CGGCTGGTCCTTCAT\nForm: Liquid\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296579241,"sku":"G65110-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65110-1-5c","provider":"Iright","version":"1.0","type":"link"}