{"product_id":"proteintech-g65143-1-5c","title":"Proteintech, G65143-1-5C, MultiPro® 5CFLX Anti-Human CD4 (RPA-T4)","description":"Size: 10ug\nThe CD4 (G65143-1-5C) by Proteintech is a Monoclonal antibody targeting CD4 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65143-1-5C targets CD4 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD4 is a 55-kDa transmembrane glycoprotein expressed on T helper cells, majority of thymocytes, monocytes, macrophages, and dendritic cells (PMID: 9304802; 12213222). CD4 is an accessory protein for MHC class-II antigen\/T-cell receptor interaction. It plays an important role in T helper cell development and activation (PMID: 9539765; 3112582). CD4 serves as a receptor for the human immunodeficiency virus (HIV) (PMID: 9304802).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD4 (RPA-T4)\nCalculated Molecular Weight: 55 kDa\nGenBank Accession Number: BC025782\nGene Symbol: CD4\nGene ID (NCBI): 920\nENSEMBL Gene ID: ENSG00000010610\nRRID: AB_3673919\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTCTTACAACGCAGTCCCATATAAGAAA\nBarcode Sequence: GTCTTACAACGCAGT\nForm: Liquid\nUNIPROT ID: P01730\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297267369,"sku":"G65143-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65143-1-5c","provider":"Iright","version":"1.0","type":"link"}