{"product_id":"proteintech-g65165-1-5c","title":"Proteintech, G65165-1-5C, MultiPro® 5CFLX Anti-Human CD86 (BU63)","description":"Size: 10ug\nThe CD86 (G65165-1-5C) by Proteintech is a Monoclonal antibody targeting CD86 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65165-1-5C targets CD86 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD86 (also known as B7.2) is a costimulatory molecule belonging to the immunoglobulin superfamily. Primarily expressed on antigen-presenting cells (APCs), including B cells, dendritic cells, and macrophages, CD86 is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of CD86 with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of CD86 with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: B-lymphoblastoid cell line ARH 77 Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD86 (BU63)\nCalculated Molecular Weight: 329 aa, 38 kDa\nGenBank Accession Number: BC040261\nGene Symbol: CD86\nGene ID (NCBI): 942\nENSEMBL Gene ID: ENSG00000114013\nRRID: AB_3673923\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGAGTTGCGAAGTTCCCATATAAGAAA\nBarcode Sequence: CCGAGTTGCGAAGTT\nForm: Liquid\nUNIPROT ID: P42081\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888298381481,"sku":"G65165-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65165-1-5c","provider":"Iright","version":"1.0","type":"link"}