{"product_id":"proteintech-g65190-1-5c","title":"Proteintech, G65190-1-5C, MultiPro® 5CFLX Anti-Human CD18 (TS1\/18)","description":"Size: 10ug\nThe CD18 (G65190-1-5C) by Proteintech is a Monoclonal antibody targeting CD18 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65190-1-5C targets CD18 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD18, also known as integrin beta-2, is a transmembrane protein that forms heterodimers with CD11a, CD11b, CD11c, CD11d (PMID: 1968349). CD11a\/CD18 (LFA-1) is expressed by all leukocytes, while CD11b\/CD18 (Mac-1) and CD11c\/CD18 (p150,95) are normally restricted to expression on monocytes, macrophages, polymorphonuclear lymphocytes (PMNs), and natural killer cells (PMID: 1968349; 3109455; 10946284). CD18 plays an important role in mediating cell adhesion during immune response and defects of CD18 cause leukocyte adhesion deficiency (PMID: 3594570).\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human Beta 2 Integrin Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD18 (TS1\/18)\nCalculated Molecular Weight: 85 kDa\nGenBank Accession Number: BC005861\nGene Symbol: CD18\nGene ID (NCBI): 3689\nENSEMBL Gene ID: ENSG00000160255\nRRID: AB_3673928\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGTGGTTGGAAGCACCCCATATAAGAAA\nBarcode Sequence: CGTGGTTGGAAGCAC\nForm: Liquid\nUNIPROT ID: P05107\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296480937,"sku":"G65190-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65190-1-5c","provider":"Iright","version":"1.0","type":"link"}