{"product_id":"proteintech-g65191-1-5c","title":"Proteintech, G65191-1-5C, MultiPro® 5CFLX Anti-Human CD29 (TS2\/16)","description":"Size: 10ug\nThe CD29 (G65191-1-5C) by Proteintech is a Monoclonal antibody targeting CD29 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65191-1-5C targets CD29 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nIntegrin beta-1 (ITGB1), also named as CD29, is a 130 kDa single chain type I glycoprotein that is expressed in a heterodimeric complex with one of six distinct α subunits, comprising the very late activation antigen (VLA) subfamily of adhesion receptors. It is one of the essential surface molecules expressed on human MSC from bone marrow and other sources. The β1 subunit is also broadly expressed on lymphocytes and monocytes, weakly expressed on granulocytes, and not expressed on erythrocytes. These receptors are involved in a variety of cell-cell and cell-matrix interactions.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD29 (TS2\/16)\nCalculated Molecular Weight: 88 kDa\nGenBank Accession Number: BC020057\nGene Symbol: Integrin beta 1\nGene ID (NCBI): 3688\nENSEMBL Gene ID: ENSG00000150093\nRRID: AB_3673929\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGAGAGACACGCATCCCCATATAAGAAA\nBarcode Sequence: TGAGAGACACGCATC\nForm: Liquid\nUNIPROT ID: P05556\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296939689,"sku":"G65191-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65191-1-5c","provider":"Iright","version":"1.0","type":"link"}