{"product_id":"proteintech-g65192-1-5c","title":"Proteintech, G65192-1-5C, MultiPro® 5CFLX Anti-Human CD2 (TS1\/8)","description":"Size: 10ug\nThe CD2 (G65192-1-5C) by Proteintech is a Monoclonal antibody targeting CD2 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65192-1-5C targets CD2 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD2 is a cell surface glycoprotein present on a majority of thymocytes, all mature T cells and subset of NK cells but not on B lymphocytes. It is a pan T-cell marker. CD2 interacts with lymphocyte function-associated antigen (LFA-3\/CD58) and CD48\/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain is implicated in the signaling function.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD2 (TS1\/8)\nCalculated Molecular Weight: 351 aa, 39 kDa\nGenBank Accession Number: BC033583\nGene Symbol: CD2\nGene ID (NCBI): 914\nENSEMBL Gene ID: ENSG00000116824\nRRID: AB_3673930\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGTAGAGACAGTTATAACCCATATAAGAAA\nBarcode Sequence: TAGAGACAGTTATAA\nForm: Liquid\nUNIPROT ID: P06729\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296644777,"sku":"G65192-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65192-1-5c","provider":"Iright","version":"1.0","type":"link"}