{"product_id":"proteintech-g65198-1-5c","title":"Proteintech, G65198-1-5C, MultiPro® 5CFLX Anti-Human CD21 (BU32)","description":"Size: 10ug\nThe CD21  (G65198-1-5C) by Proteintech is a Monoclonal antibody targeting CD21  in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65198-1-5C targets CD21  in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nCD21, also known as complement receptor type 2 (CR2), complement C3d receptor, and Epstein-Barr virus receptor, is a transmembrane protein that contains a small cytoplasmic domain, a transmembrane region and an extracellular domain consisting of 15 tandem short consensus repeat sequences (PMID: 6230668; 2551147). It is expressed on B cells, follicular dendritic cells, thymocytes and a subset of peripheral T cells (PMID: 26119182). CD21 binds complement fragments C3d, C3dg and iC3b and acts as a receptor for the Epstein-Barr virus (PMID: 7753047). On B cells, together with CD19 and CD81, CD21 forms a complex that functions as a co-receptor to the BCR (PMID: 7542009). It is involved in B cells activation and functions.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: N\/A Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD21 (BU32)\nCalculated Molecular Weight: 1092 aa, 119 kDa\nGenBank Accession Number: BC136394\nGene Symbol: CD21\nGene ID (NCBI): 1380\nENSEMBL Gene ID: ENSG00000117322\nRRID: AB_3673933\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACAATAATGTCAACCCATATAAGAAA\nBarcode Sequence: CCACAATAATGTCAA\nForm: Liquid\nUNIPROT ID: P20023\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888296710313,"sku":"G65198-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65198-1-5c","provider":"Iright","version":"1.0","type":"link"}