{"product_id":"proteintech-g65253-1-5c","title":"Proteintech, G65253-1-5C, MultiPro® 5CFLX Anti-Human CD64 (10.1)","description":"Size: 10ug\nThe CD64 (G65253-1-5C) by Proteintech is a Monoclonal antibody targeting CD64 in Single Cell (Intra), Single Cell applications with reactivity to Human samples\nG65253-1-5C targets CD64 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\nPositive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\nSINGLE CELL: \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nFcγ receptor comprise a multigene family of integral membrane glycoproteins that exhibit complex activation or inhibitory effects on cell functions after aggregation by complexed immunoglobulin G (IgG) (PMID: 17005690 ). CD64, also known as FcγRIA, is a high-affinity receptor for the Fc region of IgG. It is expressed by monocytes\/macrophages, activated neutrophils, dendritic cells, and early myeloid cells (PMID: 23293080; 19642859; 7680917). CD64 functions in both innate and adaptive immune responses.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1, kappa\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: Human rheumatoid synovial fluid cells and fibronectin-purified monocytes. Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human CD64 (10.1)\nCalculated Molecular Weight: 374 aa, 43 kDa\nGenBank Accession Number: BC032634\nGene Symbol: FCGR1A\nGene ID (NCBI): 2209\nENSEMBL Gene ID: ENSG00000150337\nRRID: AB_3673939\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCATCGCCAGCGCGGCCCATATAAGAAA\nBarcode Sequence: CCATCGCCAGCGCGG\nForm: Liquid\nUNIPROT ID: P12314\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888297857193,"sku":"G65253-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g65253-1-5c","provider":"Iright","version":"1.0","type":"link"}