{"product_id":"proteintech-g66920-1-5c","title":"Proteintech, G66920-1-5C, MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9)","description":"Size: 10ug\nThe NFKB2 (G66920-1-5C) by Proteintech is a Monoclonal antibody targeting NFKB2 in Single Cell (Intra) applications with reactivity to Human samples\nG66920-1-5C targets NFKB2 in Single Cell (Intra) applications and shows reactivity with Human samples.\n\u003cb\u003eTested Applications\u003c\/b\u003e\nPositive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.\n\u003cb\u003eRecommended dilution\u003c\/b\u003e\nSINGLE CELL (INTRA): \u0026lt;0.5ug\/test\n\u003cb\u003eBackground Information\u003c\/b\u003e\nNF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA\/p65, RELB, NFKB1\/p105, NFKB1\/p50, REL and NFKB2\/p52. NFKB2 appears to have dual functions such as cytoplasmic retention of attached NF-kappa-B proteins by p100 and generation of p52 by a cotranslational processing. The proteasome-mediated process ensures the production of both p52 and p100 and preserves their independent function. P52 binds to the kappa-B consensus sequence 5'-GGRNNYYCC-3', located in the enhancer region of genes involved in immune response and acute phase reactions. P52 and p100 are respectively the minor and major form; the processing of p100 being relatively poor. Isoform p49 is a subunit of the NF-kappa-B protein complex, which stimulates the HIV enhancer in synergy with p65.\n\u003cb\u003eSpecification\u003c\/b\u003e\nTested Reactivity: Human\nHost \/ Isotype: Mouse \/ IgG1\nClass: Oligo Conjugate\nType: Monoclonal\nImmunogen: CatNo: Ag28543 Product name: Recombinant human NFKB2 protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 600-899 aa of BC002844 Sequence: GLYPVHLAVRARSPECLDLLVDSGAEVEATERQGGRTALHLATEMEELGLVTHLVTKLRANVNARTFAGNTPLHLAAGLGYPTLTRLLLKAGADIHAENEEPLCPLPSPPTSDSDSDSEGPEKDTRSSFRGHTPLDLTCSTKVKTLLLNAAQNTMEPPLTPPSPAGPGLSLGDTALQNLEQLLDGPEAQGSWAELAERLGLRSLVDTYRQTTSPSGSLLRSYELAGGDLAGLLEALSDMGLEEGVRLLRGPETRDKLPSTEVKEDSAYGSQSVEQEAEKLGPPPEPPGGLCHGHPQPQVH Predict reactive species\nFull Name: MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9)\nCalculated Molecular Weight: 97 kDa\nGenBank Accession Number: BC002844\nGene Symbol: NFKB2\nGene ID (NCBI): 4791\nENSEMBL Gene ID: ENSG00000077150\nRRID: AB_3673962\nConjugate: 5CFLX\nFull Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAAGTGTGACATCTCCCATATAAGAAA\nBarcode Sequence: CGAAGTGTGACATCT\nForm: Liquid\nUNIPROT ID: Q00653\nStorage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.\nStorage Conditions: 2-8°C Stable for one year after shipment.","brand":"Proteintech","offers":[{"title":"Default Title","offer_id":46888299430057,"sku":"G66920-1-5C","price":0.99,"currency_code":"USD","in_stock":true}],"url":"https:\/\/iright.com\/es\/products\/proteintech-g66920-1-5c","provider":"Iright","version":"1.0","type":"link"}